id
stringlengths
2
9
source
stringclasses
1 value
version
stringclasses
1 value
added
stringlengths
24
24
created
stringlengths
24
24
text
stringlengths
239
10.1k
120163870
s2ag/train
v2
2019-04-18T13:07:41.433Z
2014-02-17T00:00:00.000Z
A mixed integer linear programming solution for single hoist multi-degree cyclic scheduling with reentrance This article considers single hoist multi-degree cyclic scheduling problems with reentrance. Time window constraints are also considered. Firstly, a mixed integer programming model is formulated for multi-degree cyclic hoist scheduling without reentrance, referred to as basic lines in this article. Two valid inequalities corresponding to this problem are also presented. Based on the model for basic lines, an extended mixed integer programming model is proposed for more complicated scheduling problems with reentrance. Phillips and Unger's benchmark instance and randomly generated instances are applied to test the model without reentrance, solved using the commercial software CPLEX. The efficiency of the model is analysed based on computational time. Moreover, an example is given to demonstrate the effectiveness of the model with reentrance.
12063570
s2ag/train
v2
2018-04-03T00:26:00.760Z
2004-08-01T00:00:00.000Z
Roles of chemokines in thymopoiesis: redundancy and regulation. Thymus is the primary lymphoid organ involved in the development of thymocytes. Maturation related events of thymocytes within thymus, especially the widely discussed directional migration of thymocytes, is regulated by chemokines via chemokine receptors mediated signaling pathway. Multiple types of chemokines and chemokine receptors, as components of the network-interaction within thymic microenvironment, are involved in the thymopoiesis. It appears that these chemokines are functionally redundant and such phenomenon may be explained not only by the promiscuous, non-one-to-one matching between ligands-receptors within CXC or CC chemokine subfamily, but also by the various spatio-temporal expression patterns within different cell types and developmental stages. The redundancy and regulation of thymus expressed chemokines and chemokine receptors during thymocyte development are herein discussed.
7766320
s2ag/train
v2
2014-10-01T00:00:00.000Z
2005-01-01T00:00:00.000Z
Ground-Water Flow Analysis in the Slope Above Shum Wan Road On August 13, 1995, a slope above Shum Wan Road failed due to high rainfall and caused a 30-m section of Nam Long Shan Road to collapse. The slope consists of weathered tuffs with a clay layer on the surface ofthe failure. A hydrogeological study was carried out by saturated finite difference grid model, MODFLOW, for the slope at the Shum Wan Road area. From the ground-water model, it was found that the ground-water level reached three meters below the ground surface during failure. The model is sensitive to recharge and specific yield. The presence of the clay layer helped to maintain a high ground-water level. Stability analyses were performed using SLOPE/W. The result of stability analyses showed that the factor of safety, F, decreased due to the rising initial water table. On the 31st of July, the factor of safety was 1.41, and dropped down to 1.01 on the 3rd of August. The factor of safety again rose back to 1.31 on the 8th of August and it finally dropped down to 0.99 on the morning of the 13th of August. The present study showed that the antecedent rainfall had some influence on stability of the slope. The amount of water in the form of seepage, which drained out from the seepage surface from the lower part of the slope, is quantified and found to be 790 m• Preventive measures can be taken by inserting horizontal pipes in the slope to drain out the ground water in the form of seepage or by covering the slope with shortcrete or chunam.
35975070
s2ag/train
v2
2017-04-08T02:56:50.898Z
2012-06-01T00:00:00.000Z
Survival of patients after ST-elevation myocardial infarction: external validation of a predictive biomarker model. To the Editor: Early risk stratification has the potential to play an important role in ST-elevation myocardial infarction (STEMI)1 patients who are to be treated with primary percutaneous coronary intervention (PCI). Several risk scores have been developed for STEMI patients; however, most risk scores require many variables, making them more difficult to use in clinical practice. The long-term prognostic value of biomarker measurements for glucose, N-terminal pro–brain type natriuretic peptide (NT-proBNP), and estimated glomerular filtration rate (eGFR) taken early after admission has recently been demonstrated for STEMI patients (1). Damman and coworkers have shown that a multimarker model including these biomarkers improved the prediction of mortality over that provided by established risk factors derived from the Thrombolysis In Myocardial Infarction (TIMI) score, which include age, body mass index, diabetes, hypertension, systolic blood pressure, heart rate, anterior myocardial infarction, and time to treatment (1, 2). Moreover, a simplified risk score developed with the 3 biomarkers identified low-, intermediate- and high-risk subgroups with respect to mortality. The best way to evaluate such a model is to perform an external validation study of the predictors in a new and independent …
78464920
s2ag/train
v2
2019-03-16T13:11:29.574Z
1979-03-01T00:00:00.000Z
Book Review: Advances in Parenteral Nutrition with certain carcinomas; tables devoted to the conclusively established associations; data on ABO-distribution in the healthy, by age and sex; and a comprehensive review of the literature on fertility perhaps on the lines of Edwards' critique of 1957. In this edition, the fast-expanding HLA-system shares a subordinate position with the non-ABO blood groups, the haemoglobins, red-cell enzymes, plasma proteins and so forth. In future, however, its growth and importance will doubtless demand a separate volume. T M ALLAN Assistant Director Aberdeen & NE Scotland Blood Transfusion Centre
37581320
s2ag/train
v2
2017-09-14T00:43:39.860Z
2009-04-01T00:00:00.000Z
A Career and Learning Transitional Model for Those Experiencing Labour Market Disadvantage Research investigating the learning and career transitions of those disadvantaged in the labour market has resulted in the development of a four-component model to enable dis-advantaged groups to navigate learning and career transitions. The four components of the model include: the self-concept; learning and recognition; career and life planning; and new literacies. The focus of this paper will be on the career and life planning component. The research utilised a sequential mixed model design, which consisted of two phases. Phase one of the research involved a Learning Survey of approximately 250 labour market program participants in which quantitative data analysis techniques were used. Phase two involved the development of the model and testing in the field. A formative evaluation of the model in the field was undertaken, utilising a combination of both qualitative and quantitative data collection and analysis. The field test was undertaken with a labour market program for women over 45 years of age wishing to re-enter the workforce. The research has resulted in the development of a model that offers career development researchers and practitioners an alternative holistic, group-based and community-based approach to career development for disadvantaged groups.
9712220
s2ag/train
v2
2015-05-04T14:01:29.000Z
2015-05-04T00:00:00.000Z
The effect of Coulomb interactions on nonlinear thermovoltage and thermocurrent in quantum dots. In the present work, we theoretically study the nonlinear regime of charge transport through a quantum dot coupled to the source and drain reservoirs. The investigation is carried out using a nonequilibrium Green's function formalism beyond the Hartree-Fock approximation. Employed approximations for the relevant Green's functions allow to trace a transition from Coulomb blockade regime to Kondo regime in the thermoelectric transport. Effects arising when electrons move in response to thermal gradient applied across the system are discussed, including experimentally observed thermovoltage zeros.
2047170
s2ag/train
v2
2018-01-23T22:42:07.017Z
2000-01-01T00:00:00.000Z
An application of the decomposition method for second order wave equations In this paper we study the solution of a linear and nonlinear damped wave and dissipative wave equations by Adomian decomposition method. We illustrate that the analytic solutions and a reliable numerical approximation of the damped wave and dissipative wave equations are calculated in the form of a series with easily computable components. The nonhomogeneous problem is quickly solved by observing the self-canceling"noise"terms whose sum vanishes in the limit. In comparison to traditional techniques, the series based technique of Adomian decomposition method is shown to evaluate solutions accurately and cheaply.
154454520
s2ag/train
v2
2019-05-16T13:03:34.998Z
2013-10-01T00:00:00.000Z
Frontier Equity Markets: Risk Parity Lessons for Asset Allocation Are frontier markets the next emerging markets? And if so, should global equity investors include them in their portfolios? From a risk parity perspective, investors can benefit from a frontier markets allocation well in excess of the market weight of the asset class. A risk parity portfolio tends to outperform a market-cap-weighted portfolio during periods of positive equity returns, while delivering comparable returns during crisis periods. Historical data shows that even if portfolio managers cannot follow a risk parity asset allocation strategy due to benchmark tracking considerations, overweighting frontier markets can help them outperform their benchmarks during upside periods without increasing downside risks significantly.
41869820
s2ag/train
v2
2018-04-03T05:11:11.003Z
1976-02-01T00:00:00.000Z
Delayed hypersensitivity and granulomatous response after immunization with protein antigens associated with a mycobacterial glycolipid and oil droplets. A myocardial glycolipid (P3) mixed with protein antigens in oil-in-water emulsion induced lasting delayed hypersensitivity (DH) and granulomatous inflammation after intradermal injection into guinea pigs. This did not occur when P3 and bovine serum albumin (BSA) were given in Freund's incomplete adjuvant. The oil-in-water emulsions consisted of microscopic oil droplets suspended in aqueous medium. By separating oil and aqueous phases from BSA + P3 emulsion it was shown that antigen retained with oil droplets led to DH and granuloma formation. The association of antigen with oil droplets was P3 dependent and was quantitated with 125I-labeled BSA. The same phenomenon occurred with 125I-labeled rabbit gamma-globulin (RGG) + P3 emulsion. Fluorescein-conjugated RGG was observed in a particulate state within or on oil droplets in emulsion containing P3. These physical characteristics of antigen + P3 emulsion appeared to be important for immunogenicity.
8408670
s2ag/train
v2
2014-10-01T00:00:00.000Z
2010-01-01T00:00:00.000Z
The Choice of Adopting Inflation Targeting in Emerging Market Economies : Do Institutions Matter ? Over the last decade, a growing number of emerging market economies has adopted inflation targeting as monetary policy framework. In a recent paper, Freedman and Laxton (2009) ask the question “Why Inflation Targeting?”. This paper empirically investigates this question by analyzing a large set of institutional and political factors potentially associated with a country’s choice of IT in a sample of 50 emerging countries over the period of 1986-2005. Using a panel probit model, our results suggest that central bank independence, policymakers’ incentives and characteristics of political system (such as the number of veto players in government, the political stability, or the degree of federalism) play an important role in the choice of IT regime, while financial market development not matters.
205950620
s2ag/train
v2
2018-04-03T00:31:44.510Z
2009-07-01T00:00:00.000Z
The Vitamin D Status Among Tibetans UVB from the sun and intake from food are the only human sources of vitamin D. Tibet is a unique region for comparisons of these sources: (1) it lies at a low latitude and at a high altitude and has very large annual fluences of UVB; (2) the traditional Tibetan food is poor in vitamin D. Blood samples were taken from 63 persons of different age, with different occupations and staying at different places. UVB doses at these places were measured. The samples were analyzed by a standard radioimmune assay for determination of the serum concentration of 25 hydroxyvitamin D (25(OH)D). The main finding was that among nomads, there seems to be severe vitamin D deficiency (serum levels of 25(OH)D < 30 nm). We tentatively propose that the low level of 25(OH)D of nomads is related to their clothing and sun exposure habits. For persons of other occupations (students, teachers and farmers) the levels are higher, although a significant fraction of these persons also have lower levels than 75 nm, by many regarded as a limit for insufficiency related to a number of negative health conditions. The annual dose of vitamin D‐generating UVB is about five times larger in Lhasa than in Oslo. Despite this, the average vitamin D status seems to be similar, except in the case of nomads. This phenomenon is certainly related to food habits. In conclusion, the 25(OH)D status among nomads in Tibet appears to be alarmingly low. However, for people of other occupations the status is more normal.
21405870
s2ag/train
v2
2018-04-03T01:00:10.489Z
2017-04-01T00:00:00.000Z
[A rarely isolated bacterium in microbiology laboratories: Streptococcus uberis]. Streptococcus uberis is a gram-positive bacterium that is mostly responsible for mastitis in cattle. The bacterium rarely has been associated with human infections. Conventional phenotyphic methods can be inadequate for the identification of S.uberis; and in microbiology laboratories S.uberis is confused with the other streptococci and enterococci isolates. Recently, molecular methods are recommended for the accurate identification of S.uberis isolates. The aim of this report is to present a lower respiratory tract infection case caused by S.uberis and the microbiological methods for identification of this bacterium. A 66-year-old male patient with squamous cell lung cancer who received radiotherapy was admitted in our hospital for the control. According to the chest X-Ray, patient was hospitalized with the prediagnosis of ''cavitary tumor, pulmonary abscess''. In the first day of the hospitalization, blood and sputum cultures were drawn. Blood culture was negative, however, Candida albicans was isolated in the sputum culture and it was estimated to be due to oral lesions. After two weeks from the hospitalization, sputum sample was taken from the patient since he had abnormal respiratory sounds and cough complaint. In the Gram stained smear of the sputum there were abundant leucocytes and gram-positive cocci, and S.uberis was isolated in both 5% sheep blood and chocolate agar media. Bacterial identification and antibiotic susceptibility tests were performed by VITEK 2 (Biomerieux, France) and also, the bacterium was identified by matrix assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) based VITEK MS system as S.uberis. The isolate was determined susceptible to ampicillin, erythromycin, clindamycin, levofloxacin, linezolid, penicillin, cefotaxime, ceftriaxone, tetracycline and vancomycin. 16S, 23S ribosomal RNA and 16S-23S intergenic spacer gene regions were amplified with specific primers and partial DNA sequence analysis of 16S rRNA polymerase chain reaction (PCR) products were performed by 3500xL Genetic Analyzer (Applied Biosystems, USA). According to the partial 16S rRNA gene sequencing results, bacterium was confirmed as S.uberis. This report makes a significant contribution to the number of case reports of human infections caused by S.uberis as the identification was performed by current microbiological methods in our case. In conclusion, S.uberis should be evaluated as an opportunistic pathogen among the immunosuppressed patients and in addition to phenotypic bacteriological methods, the other recent microbiological methods should also be utilized for the identification.
233906720
s2ag/train
v2
2021-05-08T00:04:07.617Z
2021-02-15T00:00:00.000Z
Sensitivity Analysis of Epistemic Uncertainty on Input Parameters and System Structure Using Dempster-Shafer Theory In this article, a method is proposed to conduct a global sensitivity analysis of epistemic uncertainty on both system input and system structure, which is very common in early stage of system development, using Dempster-Shafer theory (DST). In system reliability assessment, the input corresponds to component reliability and system structure is given by system reliability function, cut sets, or truth table. A method to propagate real-number mass function through set-valued mappings is introduced and applied on system reliability calculation. Secondly, we propose a method to model uncertain system with multiple possible structures and how to obtain the mass function of system level reliability. Finally, we propose an indicator for global sensibility analysis. Our method is illustrated, and its efficacy is proved by numerical application on two case studies.
44376470
s2ag/train
v2
2018-04-03T05:46:34.608Z
2014-06-01T00:00:00.000Z
Type VII collagen and squamous cell carcinoma Recessive dystrophic epidermolysis bullosa (RDEB), an inherited blistering disease, is caused by mutations in COL7A1, the gene encoding type VII collagen (Col7), which is the main component of anchoring fibrils. Affected individuals have decreased or undetectable Col7 with skin and mucosal fragility, blistering and scarring. Over 78 7% of patients with severe generalized RDEB will die from metastatic squamous cell carcinoma (SCC) by the age of 45 years, suggesting a link between loss of Col7 and aggressive SCC. Treatment of RDEB by attempting to restore Col7 by protein, cell or gene therapy is currently the subject of intensive research, and existing and likely future clinical trials. In this issue of BJD, Pourreyron et al. engineer SCC keratinocytes derived from RDEB tumours and various controls to overexpress Col7 (up to 35 5-fold vs. normal endogenous levels), using recombinant COL7A1 cDNA in a retroviral vector. They show that high levels of Col7 expression generally induce increased migration and invasion in RDEB SCC keratinocytes, associated with an increase in activation of the phosphoinositide 3-kinase pathway, a pathway involved in regulation of migration/invasion. The authors conclude that caution should be exercised when considering therapeutic strategies where delivery of Col7 is likely to exceed greatly the levels seen under normal physiological conditions. Different models of loss/overexpression of Col7 produce varied results; however, in my opinion, the consensus view is veering towards loss of Col7 being proinvasion. Data from a Ras/IjBa-driven tumorigenesis model suggest that the noncollagenous (NC1) domain of Col7 is necessary for tumour formation by RDEB keratinocytes. However, many RDEB tumours do not express Col7. In ultraviolet-induced SCC cell lines expressing Col7, knock-down of Col7 using small inhibitory RNA promoted cell invasion and disorganized epithelial differentiation in vitro with an increase in transforming growth factor (TGF)-b signalling, a known contributor to cancer progression. In the hypomorphic mouse model of RDEB (10% Col7 expression), chemical carcinogenesis protocols produced more highly invasive tumours compared with benign papillomas in wild-type mice. The extracellular matrix composition in RDEB is permissive for tumour development, and invasion and tumour formation of RDEB SCC keratinocytes can be decreased by overexpressing Col7 in dermal fibroblasts. Finally, detailed proteome analysis of fibroblasts of patients with RDEB compared with control fibroblasts showed a decrease in basement membrane matrix components and an increase in dermal matrix proteins, TGF-b and metalloproteinase expression, but not activity, in RDEB. Patients with dominant dystrophic epidermolysis bullosa who have one normal COL7A1 allele, hence approximately 50% normal Col7, rarely develop SCC. One would hope that restoring Col7 expression in RDEB to close to 50% of normal levels would decrease TGF-b signalling, improve wound healing, decrease scarring and chronic inflammation, and restore basement membrane function towards normal levels, thus reducing the risk of SCC. However, Col7 is a powerful matrix signalling molecule and, as cautioned by Pourreyron et al., if overexpression is planned, preclinical dose–response studies will be needed in animal models.
203071570
s2ag/train
v2
2019-09-17T01:04:04.116Z
2019-08-27T00:00:00.000Z
L2 Writing Task Representation in Test-Like and Non-Test-Like Situations This mixed-methods study investigates writers’ task representation and the factors affecting it in test-like and non-test-like conditions. Five advanced-level L2 writers wrote two argumentative essays each, one in test-like conditions and the other in non-test-like conditions where the participants were allowed to use all the time and online materials they needed. The writing was done on computers, and we recorded the writing process and keystrokes using the Screen Capture Video and Inputlog programs. We audio recorded stimulated recall interviews after each writing session, with the writers reporting and commenting on their writing strategies and their reasons for following them. The findings of this study suggest that there are several factors that play a role in task representation, such as previous education, personal beliefs, and task conditions. Although these factors were present in all participants’ responses, the differences in the writers’ approaches to interpret and execute the writing were marked. The results highlight various pedagogical issues and options related to teaching writing in general and to the place of task representation on writing programs in particular.
206146970
s2ag/train
v2
2018-04-03T04:42:38.074Z
2011-12-23T00:00:00.000Z
Relaxation drinks and their use in adolescents. OBJECTIVES A new class of beverages called relaxation drinks advertises calming effects and an easy way to wind down when life gets stressful. This article examines these drinks in the context of their use in adolescents. METHODS A review of the literature relevant to relaxation drinks and their functional ingredients was conducted. RESULTS The beverages contain ingredients such as melatonin, valerian, kava, tryptophan, and other products traditionally thought to play a role in sleep, sedation, or neurocognitive function. Studies of the efficacy and safety of these supplements are limited and many have significant methodological limitations. Despite appropriate warnings placed on the labels of relaxation drinks, marketing is cleverly designed to appeal to young consumers and often evokes the experiences produced by alcohol and drug use. CONCLUSION Although moderate consumption of these beverages by healthy individuals is likely safe, an objective reduction in stress is improbable and associated adverse effects are possible.
33209770
s2ag/train
v2
2018-04-03T02:20:29.574Z
2000-09-01T00:00:00.000Z
[Distant wave interaction in the early embryogenesis of the loach Misgurnus fossilis L]. Groups of loach (Misgurnus fossilis L.) embryos of different ages were kept in different quartz cuvettes for 20-24 h so that only optic contact between the groups was possible. Subsequent observations showed that parameters of their development deviated from those in the control groups. Wave-mediated biocorrection proved to have both positive and negative effects, depending on the developmental stages of the interacting groups. Changes in spectral characteristics and polarization of biological radiation affected the results of the experiments. Various developmental abnormalities caused by distant wave-mediated interactions of embryos and specific to each combination of developmental stages and conditions of optic communication are described.
54764660
s2ag/train
v2
2016-10-08T21:04:35.663Z
2016-03-15T00:00:00.000Z
Comparing Theory of Mind Deficits and Symptoms of Attention Deficit -Hyperactivity in Smokers and Non-smokers Background and purpose: Previous studies have shown that smokers are deficient in social skills and it is possible that they have deficits in theory of mind. The aim of this study was to compare theory of mind and symptoms of attention deficit-hyperactivity between smokers and non-smokers. Materials and methods: This study was conducted in 160 man (80 smokers and 80 nonsmokers) who were selected by convenience sampling. Data was collected using the Persian version of Reading Mind from Voice (FVRMFV), Conners' Adult ADHD Rating Scale and a demographic questionnaire. Data was analysed in SPSS V. 16 applying multivariate analysis of variance and independent t-test. Results: The findings showed higher scores of smokers in attention deficit (P<0.005), hyperactivity (P<0.006), impulsivity (P<0.007), problems in self-imagination (P<0.004), and whole range of ADHD symptoms (P<0.001) compared to non-smokers, but in mind reading test, smokers performed significantly weaker than non-smokers (P<0.001(. Conclusion: Deficits in theory of mind is seen in smokers, therefore, deficits in social skills could be due to this reason in such groups.
401010
s2ag/train
v2
2018-04-03T03:04:17.111Z
1996-05-01T00:00:00.000Z
In defense of weight phobia as the central organizing motive in anorexia nervosa: historical and cultural arguments for a culture-sensitive psychological conception. OBJECTIVE Recently several proposals at dropping weight phobia as the central criterion for the differential diagnosis of anorexia nervosa have been advanced, aiming at establishing a new diagnostic category including any self-induced weight loss. The validity of weight phobia as a diagnostic criterion is defended. METHODS After summarizing clinical arguments, four groups of culturally or historically remote cases of self-induced weight loss or refusal of food are analyzed in regard to the presence of weight phobia and clinical similarity to modern anorexia nervosa (extreme fasting in the Third World, in the European late Middle Ages, early modern times, and late 19th century). RESULTS It is demonstrated that modern Western anorexia nervosa with weight phobia is clearly distinct from other groups of cases of extreme fasting without weight phobia. DISCUSSION It is concluded that the psychological motive of weight phobia should remain the central criterion for the differential diagnosis of anorexia nervosa.
131089310
s2ag/train
v2
2019-04-25T13:12:18.480Z
1979-06-01T00:00:00.000Z
Experimental Rock Deformation—the Brittle Field This is a monograph by one of the most distinguished authorities on this subject. It is an attempt to present the subject-matter in such a way that suitably advanced students will be able to understand the framework of the subject and to be able quickly to gain access to the literature. Because the work lists more than 25o0 cited references, it will serve enduringly as a reference source for those actively engaged in research in rock deformation. Though the approach emphasizes the fundamental physical aspects of brittle behaviour of rocks, i.e. a 'materials science' approach, the book should prove invaluable particularly to those interested in engineering and Earth science applications Because it is basically a guided tour of the literature the text is essentially non-mathematical. The author has clearly considered that it is more important to set out concisely the conceptual framework of each aspect of theory and experimental data. No mathematical derivations 9 of formulae are given at all. The text is organized into seven main chapters. These deal first with experimental techniques and generalizations about the phenomenology of the brittle failure stress. Then follows a discussion of the problems of the approach to a theory of brittle failure. The bulk of this chapter is built around the attempts to set up physical models of the fracture process, based on the work of Griffith. The next chapters deal with friction and sliding phenomena. Then follows a review of the physical property changes that accompany loading towards failure, through the peak stress and into the post-failure regime. Dilatancy, acoustic emission, elastic wave velocity, and attenuation changes and transport property changes are dealt with here. The concluding chapter considers the transition from brittle to ductile behaviour, which tends to occur with increasing confining pressure and temperature. There is an appendix, which aims to introduce the basic ideas of the 'fracture mechanics' approach used in engineering. In view of its growing importance in rock mechanics, I was surprised that it was relegated to the status of an appendix. Furthermore, little attention was given in this section to the phenomenon of slow crack growth and atomistic aspects of fracture. However, it is difficult to be critical of a work that sets out to present an author's personal overview of a large and growing subject area. Different readers will inevitably feel that the coverage is patchy in some areas. There can be no doubt that this book will be widely welcomed as a valuable and unique contribution to an interdiscipline between materials science, engineering rock mechanics, structural geology, and geophysics.
42394110
s2ag/train
v2
2018-04-03T05:18:30.803Z
2001-09-01T00:00:00.000Z
8-Prenylnaringenin, the phytoestrogen in hops and beer, upregulates the function of the E-cadherin/catenin complex in human mammary carcinoma cells. The E-cadherin/catenin complex is a powerful invasion suppressor in epithelial cells. It is expressed in the human MCF-7 breast cancer cell line family, but functionally defective in the invasive MCF-7/6 variant. Previous experiments have shown that IGF-I, tamoxifen, retinoic acid and tangeretin are able to upregulate the function of this complex in MCF-7/6 cells. We investigated the effect of 8-prenylnaringenin (8-PN), the phytoestrogen present in hops and beer, on aggregation, growth and invasion in MCF-7/6 cells. 8-PN was found to stimulate E-cadherin-dependent aggregation and growth of MCF-7/6 cells in suspension. These effects could be inhibited by the pure anti-estrogen ICI 182,780. 8-PN did not affect invasion of MCF-7/6 cells in the chick heart assay in vitro. In all these aspects 8-PN mimics the effects of 17beta-estradiol on MCF-7/6 cells.
26360360
s2ag/train
v2
2018-04-03T00:42:47.206Z
2010-12-01T00:00:00.000Z
Landmark advances in the development of erythropoietin This is a Minireview covering landmarks or milestones in the development of erythropoietin (EPO). Thirty-nine landmark advances have been identified, which cover the period 1863–2003. Several reports are included that directly support these original landmark advances. This Minireview also updates some of the advances in EPO research since my last Minireview update on EPO published in this journal in 2003. The areas of EPO research updated are: sites of production; purification, assay and standardization; regulation; action; use in anemias; extraerythropoietic actions; adverse effects; and blood doping. The new reports on the use of EPO in the therapy of myocardial infarction; stroke and other neurological diseases; diabetic retinopathy and other retinal diseases are also covered.
12435410
s2ag/train
v2
2017-02-11T05:57:59.985Z
2007-04-22T00:00:00.000Z
Collaborative Context-Awareness and Reasoning for Optimised Service Delivery This paper illustrates an infrastructure based system designed to collect and interpret contextual information in ubiquitous networking environments. Its aim is to support optimised delivery of end-user telecommunication services as well as provide to network self-management functions enriched information about users' perspective on the network performance they get for the services and applications they use. To achieve these aims we exploit collaborative context-awareness amongst end-users and their devices. Per-user and per-network aggregation of contextual information allow the representation of respectively the users' telecommunication environment and the networks' performance status. The paper also contributes a novel decision making algorithm to deliver telecommunication services that match in the best possible way end-user's requirements to current environment resources in terms of e.g. available networks and devices. The resulting model, based on fuzzy logic principles, makes the best service delivery decision given a set of network/device selection criteria and accounts also for relative importance amongst those criteria as well as for the quality of context information.
248562460
s2ag/train
v2
2022-05-09T13:16:02.130Z
2022-01-01T00:00:00.000Z
Biosynthesis and characterization of silver nanoparticles prepared using seeds of Sisymbrium irio and evaluation of their antifungal and cytotoxic activities Abstract Recent studies have shown that green synthesis of silver nanoparticles (AgNPs) and their application in the control of phytopathogenic fungi is a burgeoning field. Sisymbrium irio (Si) (London rocket) is a well-known weed that grows abundantly in Saudi Arabia from February to May. The present study is concerned with the rapid synthesis of silver nanoparticles from the aqueous seed extract of Si) in the presence of sunlight. The biosynthesized Si-AgNPs were characterized using UV-Visible spectroscopy (UV-Vis), energy dispersive X-ray (EDX) microanalysis, dynamic light scattering analysis (DLS), transmission electron microscopy (TEM), and Fourier transform infrared spectroscopy analysis (FTIR). The UV-Vis spectrum revealed a prominent surface plasmon resonance (SPR) absorption band (∼439 nm) characteristic of AgNPs. As revealed by TEM analysis, the Si-AgNPs were predominantly spheroidal in shape and measured between 4 and 51 nm, while the Z average of nanoparticles was 94.81 nm as revealed by the DLS spectrum. The FTIR spectrum displayed peaks related to important functional groups (amines, phenols, carboxylic acids, flavonoids, aromatic compounds, and esters) that aid in the reduction, encapsulation, and stability of AgNPs. The Si-AgNPs were further investigated against a panel of potent fungal phytopathogens that included Alternaria alternata, A. brassicae, Fusarium solani, F. oxysporum, and Trichoderma harzianum. The cytotoxic activity of the biosynthesized nanoparticles against human cervical cancer cell lines (HeLa) was also tested. Si-AgNPs at 80 µg·mL−1 demonstrated a marked reduction in mycelial growth and spore germination. Similarly, Si-AgNPs exhibited dose-dependent cytotoxic activity against the HeLa cell line, with an IC50 value of 21.83 ± 0.76 µg·mL−1. The results of the present study demonstrate the robust cytotoxic and antifungal activities of Si-AgNPs. Based on the findings, Si-AgNPs can be exploited to design formulations that can effectively act as anticancer agents, controlling the proliferation of cancer cells while also combating fungal phytopathogens. However, future research to understand their toxicity mechanisms is needed.
8441510
s2ag/train
v2
2018-04-03T00:05:44.027Z
1980-04-01T00:00:00.000Z
RETINAL HAEMORRHAGES IN THE NEWBORN The present study shows the frequency and severity of retinal haemorrhages in 200 newborn, of which 100 were delivered spontaneously, 51 delivered by vacuum extractor and 49 by forceps. The incidence of retinal haemorrhages was highest in the vacuum group (50%), lowest in the forceps group (16%), while the spontaneously delivered children showed an incidence of 41%.
46782210
s2ag/train
v2
2018-04-03T01:38:31.906Z
1998-11-25T00:00:00.000Z
Comparison of Rigid and Flexible Transbronchial Needle Aspiration in the Staging of Bronchogenic Carcinoma In staging bronchogenic carcinoma by transbronchial needle aspiration (TBNA), rigid histology needles are generally preferred to flexible cytology needles owing to the widespread opinion that rigid needles have higher diagnostic yield and less false-positive results. The objective of this study was to compare the efficacy and safety of the rigid and flexible TBNAs in staging bronchogenic carcinoma to establish whether a flexible cytology needle method can replace the rigid needle. A prospective study was conducted in 138 consecutive patients with extra- or endobronchial masses suggestive of bronchogenic carcinoma and amenable to surgical procedures. All 8 mm and larger paratracheal, carinal, hilar and/or main bronchial lymph nodes determined before bronchoscopy by computed tomography (CT) were sampled by successive 18-gauge rigid and 21-gauge flexible TBNAs in the same session. The anatomic landmarks were followed precisely during TBNAs, and a proper technique applied in sampling and specimen processing. Malignant lymph node involvement was specified in 97 (72%) cases of bronchogenic carcinoma by rigid, and in 89 (66%) by flexible TBNA. There were 4 (100%) benign cases (3 with tuberculosis and 1 with sarcoidosis) of 101 (73%) with positive rigid TBNAs (82 with histological and 19 with cytological specimens). TBNAs determined malignant lymph node involvement in a total of 104 (78%) patients. Of 30 TBNA-negative patients, 14 were proven to have false-negative TBNAs by mediastinoscopy/mediastinotomy/minithoracotomy, and 16 to have true-negative TBNAs by thoracotomy. Thoracotomy confirmed true positivity in 52 rigid and 49 flexible TBNAs, and false negativity in 4 rigid and 7 flexible TBNAs. Further staging was confirmed in these 7 cases. Four had proven false-negative results by both methods. The presence of small cell carcinoma (21) or N3 disease (27) presented a contraindication to thoracotomy in 48 TBNA-positive patients. Adequate-quality and malignant lymph node specimens were more frequently obtained by both techniques at advanced tumor and node stages. However, malignant lymph node invasion was significantly more frequent in rigid and flexible TBNA specimens only in the presence of advanced tumor status and abnormal endoscopic appearance. The sensitivities of rigid and flexible TBNAs were 74 and 70%, respectively (p > 0.05), but both had a specificity of 100%. Neither false-positive results nor serious complications other than hemorrhage of 30–100 ml (rigid: 5%, flexible: 2%) were encountered with either technique. These results indicate that in bronchogenic carcinoma, hilar and mediastinal lymph nodes can be staged by 21-gauge flexible TBNA (76%) as accurately as by 18-gauge rigid TBNA (79%) if a proper technique is applied and anatomic landmarks are followed precisely (p > 0.05).
6185710
s2ag/train
v2
2018-05-08T17:56:54.787Z
2012-01-01T00:00:00.000Z
Classification of Sculpture images Recognizing smooth objects, such as sculptures, is an unsolved problem in computer vision and pattern recognition. We study the sculpture features and aim to design a scalable classification of sculpture images. This paper serves as a design, implementation and result evaluation document, illustrating that the classification we implemented has a simpler structure and comparable matching performance. The classification we built can be used in a larger image retrieval system, as well as has potential extension on classifying other smooth objects.
250798960
s2ag/train
v2
2022-07-21T15:39:50.877Z
1990-01-01T00:00:00.000Z
Stability analysis of some periodic orbits in the hydrogen atom in parallel electric and magnetic fields The stability of some prominent periodic orbits in the hydrogen atom in parallel electric and magnetic fields is studied. For small field strengths, the application of classical perturbation theory allows for analytic treatments and provides useful information on possible types of classical motion and corresponding quantum states. Non-perturbative numerical and analytic stability analysis and calculations of the Liapunov exponent are performed for the straight-line orbit along the direction of the fields in the region of the zero-field ionization threshold. Bifurcation phenomena are discussed and related to recent photoexcitation experiments.
109716710
s2ag/train
v2
2019-04-12T13:58:16.902Z
2014-01-03T00:00:00.000Z
PLC Programmable Control Technology in the Mine Pit Transportation System This paper summarizes the definition, function, and characteristics of the programmable control technology, and especially analyzes the operation mode of the 750V DC traction power supply system, the protection setting, the defects of the original system and the factors influencing the safety of power supply. Aimed at the equipment of the PLC programmable control system used in the mine transportation system in recent years, combining parts of the PLC programmable control system equipment used and installed in Tong Ting Coal Mine, this paper introduces the role of the PLC programmable control system and the economic benefits and safety effect.
41928460
s2ag/train
v2
2018-01-23T22:38:08.676Z
2007-12-01T00:00:00.000Z
Non-determinism: An abstract concept in computer science studies Non-determinism is one of the most important, yet abstract, recurring concepts of Computer Science. It plays an important role in Computer Science areas such as formal language theory, computability theory, distributed computing, and operating systems. We conducted a series of studies on the perception of non-determinism. In the current research, we studied and analyzed undergraduate Computer Science students' solutions to assignments in a course on automata and formal languages. Our findings shed some light on students' perceptions of non-determinism, their tendency to use non-determinism, and the characteristics of their non-deterministic solutions. This paper describes the current research and its results, and suggests several teaching applications.
27938610
s2ag/train
v2
2018-04-03T01:05:05.460Z
1993-07-01T00:00:00.000Z
Power of 'phase 0' chronobiologic trials at different signal-to-noise ratios and sample sizes. Clinical trials would gain from incorporating 'Phase 0' chronobiologic pilot designs both from the viewpoint of (statistical) power and cost-effectiveness. Herein, this statement is documented by power computations and is further illustrated by clinical examples answering specific questions. Power computations show the merits both of chronobiologic designs (that assign samples at equidistant intervals to cover one full cycle of anticipated pertinent rhythms) and of chronobiologic analyses (the cosinor versus the analysis of variance). Randomized clinical trials would gain from incorporating a concern for timing as well as dosing in all three stages of clinical trials (Phase I, II and III focusing on toxicity, efficacy and a comparison with the current best treatment, respectively) and could be cost-effectively preceded by 'Phase 0' trials so as to detect, sooner and with smaller sample sizes, desired or undesired effects that may otherwise be missed.
6778560
s2ag/train
v2
2014-10-01T00:00:00.000Z
1996-10-14T00:00:00.000Z
Symptoms and signs in dementia: synergy and antagonism. This paper addresses the synergy and antagonism between symptoms and signs among 2,914 elderly Canadians diagnosed in 15 categories, including no cognitive impairment, cognitive impairment but no dementia, mild, moderate and severe forms of Alzheimer's disease and vascular dementia, 4 subtypes of possible Alzheimer's disease, Parkinson's dementia, unspecified other dementias and unclassified dementias Attention is paid to the relationships between symptoms and signs rather than conventional analyses which assume independent signs. We demonstrate that dementia progression and specific aetiologies have characteristic patterns of decline and destruction from the strong synergy that exists between symptoms and signs among the population with no cognitive impairment. These findings have potential implications for the incorporation of new diagnostic criteria into existing databases.
25352810
s2ag/train
v2
2018-04-03T05:06:32.319Z
2008-09-01T00:00:00.000Z
[Hyperspectral remote sensing image classification based on radical basis function neural network]. Based on the radial basis function neural network (RBFNN) theory and the specialty of hyperspectral remote sensing data, the effective feature extraction model was designed, and those extracted features were connected to the input layer of RBFNN, finally the classifier based on radial basis function neural network was constructed. The hyperspectral image with 64 bands of OMIS II made by Chinese was experimented, and the case study area was zhongguancun in Beijing. Minimum noise fraction (MNF) was conducted, and the former 20 components were extracted for further processing. The original data (20 dimension) of extraction by MNF, the texture transformation data (20 dimension) extracted from the former 20 components after MNF, and the principal component analysis data (20 dimension) of extraction were combined to 60 dimension. For classification by RBFNN, the sizes of training samples were less than 6.13% of the whole image. That classifier has a simple structure and fast convergence capacity, and can be easily trained. The classification precision of radial basis function neural network classifier is up to 69.27% in contrast with the 51.20% of back propagation neural network (BPNN) and 40. 88% of traditional minimum distance classification (MDC), so RBFNN classifier performs better than the other three classifiers. It proves that RBFNN is of validity in hyperspectral remote sensing classification.
32252910
s2ag/train
v2
2018-04-03T02:06:32.377Z
2017-06-30T00:00:00.000Z
Computational Screening of CCR5 Inhibitors as Potential Entry Inhibitor Microbicides Using 3D-QSAR Studies, Docking and Molecular Dynamics Simulation. BACKGROUND The chemokine receptor CCR5 acts as a co-receptor for HIV binding and it is considered as an important target by CCR5 antagonists. Entry inhibitor based microbicides gain much importance nowadays as these drugs act at an early stage of HIV lifecycle and thus hinder the viral replication process in humans. The present study intends to identify a CCR5 antagonist which could be developed as a microbicide using computational approaches. METHODS The pharmacophore modeling and 3D QSAR studies was used to screen CCR5 antagonists with enhanced antagonist activity. The docking studies ranked the compounds according to their binding affinity and molecular dynamics simulation validated the stability of the enzymeligand complex. RESULTS A five point pharmacophore hypothesis HHPRR (2 hydrophobic; 1 positively ionisable; 2 aromatic ring) was generated. A statistically significant 3D QSAR model with 3 PLS factors was gen- erated for common pharmacophore hypothesis HHPRR.3 with good correlation coefficient value (R2=0.7483). The docking studies revealed that molecular interaction of CCR5 antagonists having good binding affinity are better than the microbicides taken for this study. The QSAR maps revealed the regions as a combined effect of hydrogen bond donors, hydrogen bond acceptors and hydrophobic groups which denoted the substitution of groups indicating the favorable and unfavorable regions for antagonist activity of hydroxypiperidine derivatives. The docking analysis and molecular dynamics simulation screened and validated CCR5 antagonists. CONCLUSION The present study was successful in identifying a CCR5 antagonist which could be developed as a microbicide.
247530760
s2ag/train
v2
2022-03-19T15:20:50.897Z
2022-07-01T00:00:00.000Z
Probing Dark Current Random Telegraph Signal in a Small Pitch Vertically Pinned Photodiode CMOS Image Sensor After Proton Irradiation The dark current degradation and dark current random telegraph signal (DC-RTS) after proton irradiation are studied in new scale silicon microvolumes by using a commercial CMOS image sensor. Results show that previously reported empirical models describing the displacement damage-induced degradations are still valid despite the 10–100 times smaller depletion volume used. In addition, no evidence of significant total ionizing dose effects is observed. Finally, the reduction of the fraction of RTS pixels detected and the fraction of multilevel RTS pixels is directly linked to the reduction in pixel volume.
237491460
s2ag/train
v2
2021-09-14T06:16:40.147Z
2021-09-07T00:00:00.000Z
Sarcopenia in the elderly versus microcirculation, inflammation status, and oxidative stress: A cross-sectional study. BACKGROUND Age-related mechanisms of sarcopenia associated with vascular function have been recently suggested. This study compared and tested associations between muscle mass and strength, microcirculation, inflammatory biomarkers, and oxidative stress in older adults classified as sarcopenic and non-sarcopenic. METHODS Thirty-three physically inactive individuals (72±7 yrs) were assigned to age-matched sarcopenic (SG) and non-sarcopenic (NSG) groups. Between-group comparisons were performed for appendicular skeletal mass (ASM), handgrip and isokinetic strength, microvascular function and morphology, C-reactive protein, insulin-like growth factor-1, tumor necrosis factor-alpha, interleukin-6 (IL-6), soluble vascular cell adhesion molecule-1, soluble intercellular adhesion molecule-1, endothelin-1, and oxidized low-density lipoprotein. RESULTS ASM and knee isokinetic strength were lower in SG than NSG (P <  0.05). No difference between groups was found for outcomes of microvascular function and morphology, but log-transformed IL-6 concentration was twice greater in SG vs. NSG (P = 0.02). Correlations between ASM index, handgrip and knee isokinetic strength vs. markers of microcirculatory function, capillary diameters, vascular reactivity, and endothelial injury were found only in SG. CONCLUSION Decreased ASM index and strength have been associated with microcirculatory profile, indicating that microcirculation impairment may be involved somehow in Sarcopenia development. The inflammation status, particularly elevated IL-6, seems to play an important role in this process.
247130110
s2ag/train
v2
2022-02-27T06:22:48.443Z
2022-01-01T00:00:00.000Z
Impact of Medicaid Expansion on the Diagnosis, Treatment, and Outcomes of Stage II and III Rectal Cancer Patients. BACKGROUND Insurance status has been associated with disparities in stage at cancer diagnosis. We examined how Medicaid expansion (ME) impacted diagnoses, surgical treatment, use of neoadjuvant therapies (NCRT), and outcomes for Stage II and III rectal cancer. STUDY DESIGN We used 2010-2017 American College of Surgeons National Cancer Database (NCDB) to identify patients ages 18-65, with Medicaid as primary form of payment, and were diagnosed with Stage II or III rectal cancer. Patients were stratified based on Census bureau division's ME adoption rates of High, Medium, Low. Overall trends were examined, and patient characteristics and outcomes were compared before and after ME date of 1/1/2014. RESULTS Over 8 years of NCDB data examined, there was an increasing trend of Stage II and III rectal cancer diagnoses, surgical resection, and use of NCRT for Medicaid patients. We observed an increase in age, proportion of White Medicaid patients in Low ME divisions, and proportion of fourth income quartile patients in High ME divisions. Univariate analysis showed decreased use of open surgery for all 3 categories after ME, but adjusted odds ratios (aOR) were not significant based on multivariate analysis. NCRT utilization increased after ME for all 3 ME adoption categories and aOR significantly increased for Low and High ME divisions. ME significantly decreased 90-day mortality. CONCLUSIONS Medicaid expansion had important impacts on increasing Stage II and III rectal cancer diagnoses, use of NCRT, and decreased 90-day mortality for patients with Medicaid. Our study supports increasing health insurance coverage to improve Medicaid patient outcomes in rectal cancer care.
46603060
s2ag/train
v2
2017-02-11T12:37:10.574Z
2007-08-24T00:00:00.000Z
Applying Wireless Sensor Networks to Context-Awareness in Ubiquitous Learning Context aware ubiquitous learning is pervasive and persistent, allowing learners to access education calmly, flexibly and seamlessly. The objective of context aware ubiquitous learning is to move e- learning and mobile learning a step further from learning at anytime anywhere to be at the right time and right place with right learning resources and right learning peers. In recent years, wireless sensor networks have become an evolving technology that has a wide range of potential applications in ubiquitous computing. We introduced an image of context- awareness in ubiquitous learning based on wireless sensor networks. We showed the architecture of context-awareness in ubiquitous learning in general, introduced the components of a sensor node and protocol stack of wireless sensor networks, and pointed out conclusions and open research issues with regard to context aware ubiquitous learning.
13963410
s2ag/train
v2
2014-10-01T00:00:00.000Z
2013-01-01T00:00:00.000Z
International Conference on the Evolution of Language ( Evolang 9 ) The 1990’s have witnessed a resurrection of an interest in the origins of language (in fact, such an interest had never actually faded). Although pin-pointing the exact triggers behind the initial sparkles is difficult, one may advocate for the integration of a number of scientific advances, including the first computer simulations of the self-organized emergence and convergence of linguistic conventions (Hurford 1989, Steel 1996), the significant progress in the systematic analysis of mtDNA or Y chromosome genetic distributions across the world (Cann et al. 1987, Underhill et al. 2000), the synthesis of the data from genetics, archaeology, and linguistics (Cavalli-Sforza et al. 1988, 1992), and many others. In 1996, the first Conference on the Evolution of Language (Evolang) was held in Edinburgh for the purpose of fostering a dialog between scholars of diverse backgrounds. At the center of discussions — and in opposition to a generativist framework minimizing the value of such an attempt (Chomsky 1972, Berwick 1998) — laid an effort to account for the properties of the faculty of language in light of modern evolutionary theory (Hurford et al. 1998). The 9th Evolang conference (Evolang9), which took place in Kyoto 13–16 March 2012, was once again an opportunity for scholars from a wide range of disciplines to gather and bridge their lines of arguments (McCrohon et al. 2012, Scott-Phillips et al. 2012). Since the origins and evolution of language have long been the research foci in both evolutionary linguistics and biolinguistics, we provide here a review of the variety of reports that was brought forward during Evolang9. Without being able to pay justice to the wide scope of all contributions that were made, we mainly summarize and frame the primary arguments that echoed during the conference, highlight significant evolutions of the field both in terms of methods and content, and present our opinions on future research in this line.
218837110
s2ag/train
v2
2020-05-23T13:01:55.008Z
2020-05-21T00:00:00.000Z
Histopathological changes in tear-secreting tissues and cornea in a mouse model of autoimmune disease The tear film covers the cornea, and its abnormalities (including immunological) induce dry eye. Using autoimmune disease model mice, BXSB/MpJ-Yaa (BXSB-Yaa), histopathological changes in the eye and tear-secreting tissues were examined using histopathology, immunohistochemistry, and electron microscopy at 8, 20, and 28 weeks for early, middle, and late disease stages. Early and middle stage BXSB-Yaa showed increased serum autoantibody and spleen weight-to-body weight (S/B) ratio, respectively, and higher tear volume than controls, BXSB/MpJ (BXSB), at early stages, which decreased with ageing and negatively correlated with autoimmune disease indices. Smaller Meibomian gland acini, intraorbital lacrimal glands, and Harderian gland acinar cells were seen in late stage BXSB-Yaa than in BXSB; the latter two indices decreased with ageing and negatively correlated with the S/B ratio. Cell infiltration occurred in the middle stage BXSB-Yaa extraorbital lacrimal gland, and acinar cells were smaller than BXSB. The conjunctival goblet cells decreased from early to middle stages in both strains, but in BXSB-Yaa, they increased at late stages with a partial lack of microvilli on the cornea and were inversely altered with anterior epithelium thickness through ageing, suggesting that they compensated for anterior epithelium damage. In conclusion, the tear film was unstable due to an autoimmune disease condition in BXSB-Yaa. Impact statement Cornea, an outermost layer of mammalian eye, is protected by tear film and abnormalities of tear film causes dry eye. Dry eye injures the cornea which results lower vision in patients. Several factors cause dry eye, including altered systemic conditions, environment, and immunological abnormality of the patient in autoimmune disease like Sjögren’s syndrome (SS). However, the detailed pathology of autoimmune abnormality-mediated dry eye is unclear. Here we demonstrated that systemic autoimmune abnormality in BXSB-Yaa mice was associated with histological changes in the exocrine glands and cornea of the eyes. We also showed that BXSB-Yaa mice developed mild or early stage dry eye-like disease and explain the existence of a compensatory mechanism associated with the dysfunction of these tissues. Thus, BXSB-Yaa could be a model for SS-like disease-associated dry eye and these data would contribute to the understanding of the pathogenesis of autoimmune-related dry eye disease.
61418760
s2ag/train
v2
2019-02-15T14:20:16.970Z
2011-10-04T00:00:00.000Z
The Last Dragonslayer by J. Fforde Fforde, Jasper. The Last Dragonslayer. Toronto: HarperCollins, 2011. Print. Almost-16-year-old Jennifer Strange is caught in a unique situation. As an orphan and an indentured servant of Kazam Mystical Arts, an employment agency for the magically gifted, Jennifer suddenly finds herself running the agency due to the mysterious disappearance of her boss, Mr. Zambini. Even worse, magical power has been dwindling everywhere and rumors are swirling about the forthcoming death of the last dragon. Accompanied by her faithful Quarkbeast, Jennifer sets out to investigate these strange events, find Mr. Zambini, and stop the disappearance of magic from her world. Along the way, she becomes the central figure in a firestorm of media intrigue and faces the combined threats of fame, prophecies, jail, assassination attempts, and 16 marriage proposals. Known primarily for his adult novels, The Last Dragonslayer is Jasper Fforde’s first foray into fiction for teens; however, his trademark quirky humour, original thinking, and dry wit are present in abundance. Furthermore, Fforde’s characters are complex, well-drawn, and extremely relatable; in particular, Jennifer’s cool-headed intelligence and wry observations will appeal to teen girls and boys alike. Parents who (rightfully) lament the dearth of teen girl role models in YA fiction will enjoy handing this book to their daughters. There is no denying that Dragonslayer is complicated; Fforde never condescends to his young audience, and he pulls no punches when introducing and playing with complex ideas. However, Jennifer’s first-person narration ably guides readers through the wackiness of her world, making a convoluted, diverse, suspenseful plot ultimately, and satisfyingly, character-driven. This could be the best book your teen reads all year. Highly recommended: 4 out of 4 stars Reviewer: Amy Paterson Amy Paterson is a Public Services Librarian at the University of Alberta’s H. T. Coutts Education Library. She was previously the Editor of the Dalhousie Journal of Interdisciplinary Management and is very happy to be involved in the Deakin Review and the delightful world of children’s literature.
20545060
s2ag/train
v2
2018-04-03T04:17:02.868Z
1999-12-01T00:00:00.000Z
DNA content by in situ fluorescence imaging and S-phase detection, with chromatin structure preserved. OBJECTIVE To test the feasibility of in situ DNA quantitation of adherent cells' nuclei by fluorescence imaging, preserving chromatin structure and to follow-up S phase, in relation to DNA content, in order to assess the precision of DNA measurements. STUDY DESIGN Double labeling experiments involved total DNA staining with Hoechst 33342 and BrdU immunostaining (after either Br photolysis and DNA strand break labeling by terminal transferase or acid denaturation) to detect replicating DNA. An epifluorescence microscope was used, images captured with a CCD camera and quantitative total DNA measurements done in 12 bits with IPLab software. BrdU results were related to DNA content on an individual cell basis. Cell cycle analyses were run with Imastat software (developed in the laboratory) on Hoechst-stained cells and on double labeled cells. RESULTS In cells progressing through the cycle, as assessed by BrdU, a corresponding increase in DNA content was measured. Early S differed from G1 (P < .05). Imastat analyses gave a CV for GI peak of 6-7%. CONCLUSION Quantitative fluorescence imaging allows a sensitive determination of DNA content for adherent-cell nuclei in situ. Topologic analyses of nuclear components will be possible in relation to DNA content.
27594310
s2ag/train
v2
2018-04-03T01:00:43.742Z
1996-04-01T00:00:00.000Z
DNA gyrase gyrA mutations in quinolone-resistant clinical isolates of Staphylococcus haemolyticus Staphylococci are significant human pathogens. Coagulasepositive Staphylococcus aureus causes a variety of infections. Recently, coagulase-negative staphylococci have been recognized as important pathogens. Fluoroquinolones have been widely used to treat staphylococcal infections. However, quinolone-resistant strains have been clinically isolated among S. aureus and Staphylococcus epidermidis. One of the mechanisms of resistance to quinolones is an alteration of DNA gyrase. DNA gyrase contains the two subunits of GyrA and two subunits of GyrB encoded by the gyrA and gyrB genes, respectively. DNA gyrase catalyzes ATP-dependent supercoiling of DNA and is a target of the quinolones (3). Ser-843Leu, Ser-843Ala, Ser-853Pro, Glu-883Gly, and Glu-883Lys changes were identified in S. aureusGyrA (1) and a Ser-843Phe mutation was observed in S. epidermidis GyrA (2). These mutations fall within a small area of the Nterminal portion of the GyrA protein. Therefore, this region is designated the quinolone resistance-determining region (QRDR) of the gyrA gene (4). Studies of quinolone resistance in the coagulase-negative staphylococci, except for S. epidermidis, are not advanced. In this study, we cloned and sequenced the QRDR of the gyrA genes from clinical isolates of coagulase-negative Staphylococcus haemolyticus and identified the mutation in quinoloneresistant strains. Twenty-seven S. haemolyticus strains were clinically isolated from urine samples between 1991 and 1994. Among these strains, 15 were quinolone resistant (MIC of ciprofloxacin, ^6.25 mg/ml). Chromosomal DNAs were prepared from quinolone-susceptible and -resistant S. haemolyticus strains, and PCR was performed to amplify the gyrA fragment, including the QRDR, with two nucleotide primers, 59TTAAATGAACA AGGTATGAC39 and 59GCCATACCTACCGCGATACC39, which were identical in sequence to nucleotide positions 157 to 176 or complementary in sequence to positions 520 to 539 of the S. aureus gyrA gene, respectively. PCR products were cloned in pT7Blue T-vector (Novagen, Madison, Wis.) and sequenced by the dideoxy chain termination method. The sequence of the QRDR in quinolone-susceptible S. haemolyticus 11068 (nucleotide sequence accession number D78568) showed 85% identity with that of S. aureus. Consequently, the deduced amino acid sequence of this region in S. haemolyticus differed at 2 positions from that in S. aureus. S. aureus had Glu and Asp residues at the NH2-terminal 88th and 96th positions in GyrA, whereas S. haemolyticus had Asp and Thr at those positions, respectively (Fig. 1). Table 1 shows MIC testing of the five clinical isolates. Four quinolone-resistant strains exhibited a fivefold or greater increase in the MICs of fluoroquinolones compared with those for susceptible isolates. The sequence of the QRDR in these four quinolone-resistant S. haemolyticus gyrA fragments differed at only 1 nucleotide position from that of the quinolone-susceptible strain 11068. The strains carried a C3T transition at the position corresponding to position 251 in S. aureus gyrA, resulting in a Ser-843Leu mutation in GyrA. These results indicate that quinolone resistance in both S. haemolyticus and S. aureus is commonly associated with the Ser843Leu mutation in GyrA. Until now, this type of change has been most frequently found in E. coli and S. aureus (1). Changes in the amino acid at the equivalent position were also observed in other quinolone-resistant species. Our results add to the accumulating evidence that a change of Ser84 in GyrA may be responsible in part of quinolone resistance.
146373510
s2ag/train
v2
2019-05-07T14:22:35.326Z
2015-10-02T00:00:00.000Z
Conditions for Consent to the Use of Neurotechnology: A Preparatory Neuroethical Approach to Risk Assessment and Reduction New developments in deep brain stimulation (DBS) enable both openand closed-loop modulation of brain structures and functions that are important to the clinical treatment of a number of neuropsychiatric disorders and conditions. Ongoing clinical trials and investigator-initiated research (IIR) in DBS have generated results that expand both (1) current understanding of neural network mechanisms operative in several neuro-cognitive, emotional and behavioral processes, and (2) the potential viability and use of DBS to alter neuro-cognitive function in clinical settings, as well as for nonclinical purposes (e.g., cognitive task performance optimization and/or emotional performance alteration). It may be that we are poised upon new horizons of possibility to employ DBS (and other neuromodulatory technologies) as treatment of brain disease, disorder, and injury, and to facilitate and/or enhance defined aspects of human thought and behavior. Frederic Gilbert (2015) revisits several fundamental neuroethical issues and questions arising from the use of interventional neurotechnology in light of these new developments in DBS. As Gilbert notes, many neuropsychiatric conditions impair patients’ sense of agency and autonomy. This fosters interest in the viability and value of DBS in restoring self-determination, and often is a strong motivation for patients seeking such treatment in the first place. Such desires can also be fueled, at least in part, by the relative “push” of a growing technological trend—what has been regarded as a technological imperative—in neuroscience and its clinical translation and applications in neurology and psychiatry. Additionally, there is an equal, if not greater, “pulling” force exerted by increasing demand-side influences and market valuation of neurotechnology (Giordano and Benedikter 2013). On one hand, patients and the public may be seduced by the lure of new technology, and may misrepresent the potential benefits that can realistically be gained. On the other, patients and the public may be intimidated by (if not frankly fearful of) possibilities for “mind control” and other deleterious (or unanticipated) effects (Giordano 2012). Thus, at the core is a need for realistic determination, and communication, of the actual capabilities and limitations of DBS or any neurotechnology (Giordano 2015). Before a neurotechnology can be advocated for use, it is essential that clinicians address a number of key questions (i.e., the “6-Ws”) that must then be framed within specific domains and dimensions of utility and effect (i.e., the “6-Cs”). This approach entails and obtains detailed assessment of the nature, intent, and realistic effect(s) and consequences of the treatment; settings and contexts of use and outcomes; how intervention can and likely will incur both the therapeutic end goal(s) and other aspects of patients’ cognitive and emotional status; and the needs for, and assurances of, continuity of clinical care and
6477460
s2ag/train
v2
2017-07-31T21:47:53.585Z
2015-05-15T00:00:00.000Z
Wastewater Analysis Indicates that Genetically Diverse Astroviruses, Including Strains Belonging to Novel Clades MLB and VA, Are Circulating within Japanese Populations ABSTRACT Human astroviruses (HAstVs) are a common etiological agent of infantile gastroenteritis. Recent studies revealed that novel astrovirus (AstV) strains of the MLB clade (MLB-AstVs) and VA clade (VA-AstVs), which are genetically distinct from the classic HAstVs, are circulating in the human population. In the present study, we quantified classic HAstVs as well as carried out a genetic analysis of classic and novel HAstVs in wastewater in Japan. The concentration of classic HAstVs in the influent water samples ranged from 104 to 105 copies per liter, and the amount removed by wastewater treatment was determined to be 2.4 ± 0.3 log10. Four types of classic HAstV strains (HAstV types 1, 2, 5, and 4/8) as well as novel AstV strains belonging to the MLB-2, VA-1, and VA-2 clades were identified using reverse transcription-PCR (RT-PCR) assays, including assays newly developed for the detection of strains of the MLB and VA clades, followed by cloning and nucleotide sequencing. Our results suggest that genetically diverse AstV strains are circulating among the human population in Japan. The newly developed (semi)nested RT-PCR assays for these novel AstV clades are useful to identify and characterize the novel AstVs in environmental waters.
238202360
s2ag/train
v2
2021-09-29T06:17:20.884Z
2021-09-28T00:00:00.000Z
Developments in the Synthesis of Mycobacterial Phenolic Glycolipids The highly lipophilic outer barrier of mycobacteria, such as M. tuberculosis and M. leprae, is key to their virulence and intrinsic antibiotic resistance. Various components of this mycomembrane interact with the host immune system but many of these interactions remain ill‐understood. This review covers several chemical syntheses of one of these components, mycobacterial phenolic glycolipids (PGLs), and outlines the interaction of these PGLs with the human immune system, as established using these well‐defined pure compounds.
22273660
s2ag/train
v2
2018-04-03T05:31:49.253Z
1988-01-01T00:00:00.000Z
[Polysaccharide-protein complexes isolated from different strains of Neisseria meningitidis serogroup B]. Fractionation of the biomass of 3 serogroup B N. meningitidis strains, obtained from solid serum-free and liquid synthetic media, by increasing concentrations of cetavlone revealed that the formation of natural polysaccharide-protein complexes with the ratio of their components approaching 1:1 was possible under the conditions ensuring the intensive synthesis of capsular polysaccharide. Two strains, 125 and 1642, grown on a solid amino peptide-containing medium regularly produced two polysaccharide-protein complexes with the protein/polysaccharide ratio approaching 1:1. One of these complexes passed easily into the supernatant fluid and could be precipitated with 0.1% cetavlone. The second complex was more firmly bound to the outer membrane of the cell and could be precipitated with 1% cetavlone. In most experiments an additional fraction with high protein content in relation to sialic acid was isolated from the biomass.
32130960
s2ag/train
v2
2018-04-03T02:05:30.740Z
1979-05-01T00:00:00.000Z
Picosecond photodetector for 257 nm to 1 mum laser pulses. Picasecond temporal response and broad spectral response photodetectors have been fabricated using commercially available diode chips. Improved photoresponse sensitivity is achieved by removing the anode gold contact which obscures the active region. Junction geometry is such that the depletion region is approximately normal to the surface being illuminated, making the device especially useful for fast UV photodetection.
13280260
s2ag/train
v2
2018-04-03T00:37:12.606Z
1995-01-01T00:00:00.000Z
Origins of attitude importance: self-interest, social identification, and value relevance. Five studies examined the relations between attitude importance and 3 of its hypothesized determinants: self-interest, social identification with reference groups or reference individuals, and cherished values. Verbal protocols, multivariate analysis of survey data, and laboratory experimentation revealed that (1) people's theories of the causes of attitude importance pointed to all 3 hypothesized predictors, (2) the 3 predictors each had significant, unique statistical associations with importance, and (3) a manipulation of self-interest yielded a corresponding change in importance. These results help clarify the nature and origins of attitude importance, challenge the widely believed claim that self-interest has little or no impact on political cognition, and identify new likely consequences of social identification processes and values.
245823910
s2ag/train
v2
2022-01-09T16:13:03.204Z
2021-11-16T00:00:00.000Z
Ecological Efficiency of Life Cycle of Concrete Fabricated Composite Slab in Earthquake Area With the development of prefabricated buildings, the construction mode of buildings has changed greatly. Infilled wall is an important part of architecture. The traditional manual masonry method is not suitable for the construction of prefabricated buildings. Precast concrete infilled wall, as a form of infilled wall suitable for the construction of prefabricated buildings, came into being. Infilled wall has a great influence on the performance of frame structure. Compared with the traditional masonry infilled wall, the concrete infilled wall has greater stiffness, better integrity and stronger bearing capacity. Based on the existing research, this paper analyzes the influence of the height width ratio of the concrete infilled wall, the wall thickness, and the tie mode with the frame on the structural performance through the finite element software Atena. Combined with the results of practical engineering modal analysis, this paper evaluates the value method of natural vibration period of concrete frame infilled wall structure, and puts forward some suggestions for Chinese codes.
35990410
s2ag/train
v2
2017-02-18T14:30:51.391Z
2010-07-04T00:00:00.000Z
Control of a high torque density seven-phase induction motor with field-weakening capability In this paper, a rotor-flux-oriented control scheme for seven-phase induction motor drives is presented. At low speed the proposed control scheme is able to increase the motor torque by adding a third harmonic component to the air-gap magnetic field. Above the base speed the control system reduces the motor flux in such a way to ensure the maximum torque capability. The validity of the proposed control scheme is confirmed by experimental tests.
26953410
s2ag/train
v2
2017-06-16T23:37:37.321Z
2014-04-01T00:00:00.000Z
[Hypothermia prevention during surgery: comparison between thermal mattress and thermal blanket]. This study aimed to compare the efficiency of the thermal blanket and thermal mattress in the prevention of hypothermia during surgery. Thirty-eight randomized patients were divided into two groups (G1 - thermal blanket and G2 - thermal mattress). The variables studied were: length of surgery, length of stay in the post-anesthetic care unit, period without using the device after thermal induction, transport time from the operating room to post-anesthetic care unit, intraoperative fluid infusion, surgery size, anesthetic technique, age, body mass index, esophageal, axillary and operating room temperature. In G2, length of surgery and starch infusion longer was higher (both p=0.03), but no hypothermia occurred. During the surgical anesthetic procedure, the axillary temperature was higher at 120 minutes (p=0.04), and esophageal temperature was higher at 120 (p=0.002) and 180 minutes (p=0.03) and at the end of the procedure (p=0.002). The thermal mattress was more effective in preventing hypothermia during surgery.
72502610
s2ag/train
v2
2019-03-10T13:06:45.490Z
1993-10-01T00:00:00.000Z
Guest Editors' Note: Global Drug Development THE SCOPE OF DRUG discovery and development has expanded and accelerated in recent years. Research efforts in drug discovery have broadened to include start-up biotechnology companies, research institutes within major domestic and international pharmaceutical companies, and useful collaborations between industry and academia. Development programs are no longer limited to one country or even one continent, but are conducted simultaneously in multiple countries geared to multiple regulatory agencies. The Cornell Symposium on Global Drug Development at which the following articles were presented was convened as a forum to exchange concepts and ideas about the worldwide nature of drug development. Topics of interest were selected to provoke education and controversy. Strategic planning and coordination of multistate trials is a major focus of activity within the industry and received substantial discussion at the symposium. Current and newer techniques for information tracking and dissemination were described. The symposium devoted considerable attention to a detailed consideration of regulatory and quality assurance issues. Of particular interest was the continuing evolution of the European Community’s approach to drug registration and marketing authorization. Finally, industry experts provided a perspective on the business ramifications of the global development process as manifest by mergers, acquisitions, and co-development planning. The symposium was among the first efforts of industry to address the opportunities, challenges, and specific issues which are associated with global scientific efforts. There is no doubt that as the pace of drug development efforts increase in the setting of a world made smaller by technological advances such as high speed data transfer through optical fibers, all of the parties involved in the drug development process will need to adapt. Research scientists will routinely collaborate with colleagues on another continent. Clinical programs will be conceived in one nation and implemented and monitored in many others. Regulatory agencies of many nations will review filings for new agents and deal with issues of worldwide safety and efficacy reporting. The global nature of the drug development process has become a reality, with a more rapid and broader development process bringing therapeutic benefit to increased numbers of patients.
248077860
s2ag/train
v2
2022-04-11T15:05:05.536Z
2022-04-08T00:00:00.000Z
Controlling Memristance and Negative Differential Resistance in Point‐Contacted Metal–Oxides–Metal Heterojunctions: Role of Oxygen Vacancy Electromigration and Electron Hopping Nonvolatile resistive switching memristance devices with a high on/off ratio are desirable for nanoelectronics such as resistive random‐access memory (RRAM) and in‐memory computing. Here, bipolar resistive switching in point‐contacted W/LaAlO3/SrTiO3(111) heterojunctions is reported, in which a Schottky barrier is formed at the metal/oxides interface, and 2d electron gas is formed at the interface of perovskite oxides. A negative differential resistance is observed in the RESET process. The result shows that the observed resistive switching is strongly associated with oxygen‐vacancies (OVs) in oxides with dominating contributions from electron hopping between OV trap sites, and can be controlled by oxygen annealing and electron injection. Remarkably, a method is developed by continuous RESET processes to increase the high resistance state by 1–3 orders of magnitude, with an on/off ratio enhanced from ≈10 to ≈104. The work provides a promising pathway to understand conduction mechanism of oxides memristors and promote its application in RRAM and in‐memory computing.
229471010
s2ag/train
v2
2020-11-26T09:03:19.324Z
2020-11-20T00:00:00.000Z
A Mathematical Approach to Modeling Physics for the Vertical Position in Synchronized Swimming In Synchronized Swimming, arguably the most demanding sport known to man, one of the most basic positions is called a vertical. In this position a swimmer’s upper body is submerged in water and their legs are held above the surface while their body is kept in a straight line. Along with the buoyancy forces of the surrounding water and the air in the lungs, swimmers must also support themselves by making movements called sculls with their arms that propel them upwards. This additional force is the applied force. The goal of this research is to use physics principles to create a mathematical model that will help assist synchronized swimmers in maximizing their scores for the vertical position. The math done in this model confirmed that the amount of applied force inversely correlates with the buoyancy force needed to lift the synchronized swimmer out of the water. Additionally, the total force pushing the synchronized swimmer upwards is the same at each level. When the collected data is fitted to a second-order polynomial comparing applied sculling force to desired score, the graph shows that the data had an R2 fit of 0.984. This knowledge could ultimately inform athletes about how to use buoyancy and other forces to their advantage which could increase their performance levels.
15833160
s2ag/train
v2
2017-03-31T01:01:16.214Z
1988-03-01T00:00:00.000Z
The effect of guar gum on the distribution of a radiolabelled meal in the gastrointestinal tract of the rat 1. The effect of addition of guar gum (5 and 10 g/l) to a radiolabelled, homogenized, baked-bean test meal on the distribution of that meal in the gastrointestinal tract was investigated in groups of male rats killed at 25, 50, 100, 200, 300 and 400 min after gavage. 2. Addition of 5 and 10 g guar gum/l significantly increased the proportion of the meal remaining in the stomach at 25 and 50 min after gavage (P <0·01). 3. The heads of the control meal and meals containing guar gum reached the distal small intestine within 25 min after gavage but radioactivity was not observed in the caecum until 100 min after administration of each of the meals. Addition of guar gum (5 and 10 g/l) delayed caecal filling even though the head of each meal reached the caecum at the same time after gavage. 4. The geometric centres of guar-gum-containing meals were proximal to that of the control meal at all times after gavage. 5. The observed delay in the passage of a guar-gum-containing meal through the stomach and small intestine is probably due to the viscous nature of the meal resisting the propulsive and mixing effects of the gastrointestinal contractions, thereby reducing access of the glucose to the absorptive epithelium. This could contribute to the observed reductions in postprandial glycaemia seen in previous studies after incorporating guar gum into a meal.
252749460
s2ag/train
v2
2022-10-07T15:10:27.662Z
2022-01-01T00:00:00.000Z
DEVELOPMENT OF THE RUSSIAN LAW OF OBLIGATIONS IN THE 1905 DRAFT CIVIL CODE The author analyzes the level of development of the civil legislation on the example of the law of obligations by means of its comparative analysis with the civil legislation in force in Russia in 1914 – the Code of Civil Laws. Examples of legal novelty in the articles of the draft Civil Code, indicating the development of the Russian law of obligations, are considered. The conclusion is made that the civil legislation developed in the draft was, in quantitative and qualitative terms, a significant step forward, bringing Russian law of obligations closer to European law.
23990060
s2ag/train
v2
2018-04-03T03:54:58.225Z
2011-10-01T00:00:00.000Z
Dietary intake, nutritional status and rehabilitation outcomes of stroke patients in hospital. BACKGROUND Nutrition affects rehabilitation through its influence on physical and mental functioning, although little attention has been paid to effects on rehabilitation outcomes. The present study aimed to describe nutritional status and food consumption in stroke patients within 2 weeks of hospital admission and before discharge, as well as to investigate the effects of nutritional and dietary factors on rehabilitation outcomes. METHODS One hundred patients from a consecutive cohort admitted to a metropolitan hospital with acute stroke were recruited and assessed by a single researcher, with 38 reassessed at discharge. Nutritional status was assessed using Mini-Nutritional Assessment and anthropometric indices and dietary intake was assessed by 1-day weighed dietary records. Rehabilitation outcomes were changes in Barthel index scores and the rehabilitation efficiency index. RESULTS Few (n = 9; 10%) consumed ≥100% of the estimated average requirement (EAR) for energy within 2 weeks of admission and 13 (33%) had energy intakes <50% of EAR before discharge. A small but increasing proportion (7% at admission, 13% at discharge) were identified as being malnourished across the inpatient stay. Younger age, lower Barthel index and a higher energy intake in the early stages of admission predicted the extent and rate of restoration of functional abilities by discharge (F = 7.503, P = 0.001; F = 14.558, P < 0.001). CONCLUSIONS Given a general finding of nutritional deterioration identified for these patients, as well as the identification of energy intake as a modifiable influence on the extent and rate of recovery, there is clearly scope for the multidisciplinary development of nutritional support for stroke patients to improve rehabilitation outcomes.
125664410
s2ag/train
v2
2019-04-22T13:04:59.667Z
1986-05-01T00:00:00.000Z
Lasers in Applied and Fundamental Research S Stenholm 1985 Bristol: Adam Hilger xiv + 273 pp price £9.95 (IOP members' price £7.95) ISBN 0 85274 808 6 This book contains four contributions that were first published as review articles in Reports on Progress in Physics, together with an introduction setting the scene for each paper and describing developments which have occurred since the articles were first written. The four topics are the interaction of laser radiation with free atoms (S Feneuille), optical bistability (E Abraham and S D Smith), nonclassical effects in the statistical properties of light (R Loudon) and Bell's theorem (J F Clauser and A Shimony).
229438610
s2ag/train
v2
2020-12-10T09:07:56.074Z
2020-12-03T00:00:00.000Z
Panitumumab-Induced Paronychia: A Case Report and a Brief Review of the Literature Panitumumab is a recombinant, fully humanized IgG2 monoclonal antibody targeting the epidermal growth factor receptor (EGFR). Panitumumab is indicated for patients with metastatic colorectal cancer with progressive refractory disease. Targeted therapies are well known to be well tolerated; however, they may induce toxicities that are distinct from those of classical chemotherapeutic agents. For instance, EGFR inhibitors (EGFRIs) are associated with some specific dermatological adverse effects, one of which is nail toxicity. Since panitumumab is fully humanized, unlike most of the other EGFRIs, it has been reported to have reduced incidence of adverse reactions. Nail-related adverse effects are frequently observed with EGFRIs. A literature search has yielded a list of reviews describing panitumumab-induced nail toxicity. However, as far as we know, there is no case report detailing this adverse effect of panitumumab. Here, we present a case of panitumumab-induced paronychia in a 60-year-old woman with metastatic colon cancer. With this case report, we would like to review the literature and discuss the possible underlying mechanisms of this condition.
24217260
s2ag/train
v2
2018-04-03T01:48:28.881Z
1982-01-01T00:00:00.000Z
[Chromosome aberrations and sister chromatid exchanges in a human lymphocyte culture exposed to diethylstilbestrol dipropionate]. Frequency of chromosome aberrations and sister chromatid exchanges (SCE) was studied in human lymphocyte culture treated with the synthetic nonsteroidal estrogen diethylstilbestrol-dipropionate in doses of 1.3 . 10(-7) M, 1.3 . 10(-6) M and 1.3 . 10(-5) M. Doses of 1.3 . 10(-6) M and 1.3 . 10(-5) M are shown to induce a significant increase in the chromosome aberration level mostly due to a rise in the number of polyploid cells. The same doses increase the frequency of SCE.
14153560
s2ag/train
v2
2014-10-01T00:00:00.000Z
2008-01-01T00:00:00.000Z
Graphical models for object segmentation Object segmentation, a fundamental problem in computer vision, remains a challenging task after decades of research efforts. This task is made difficult by the intrinsic variability of the object's shape, appearance, and its surrounding. It is compounded by the uncertainties arising from mapping the 3D world to the image plane and the noise in the acquisition systems. However, the human visual system often effectively entails the segmentation of the object from its background by fusing the bottom-up image cues with the top-down context. In this thesis we propose a novel probabilistic graphical modeling framework for object segmentation that effectively and flexibly fuses different sources of information, top and bottom, to produce highly accurate segmentation of objects in a computationally efficient manner. The main contributions of our work are: (1) We present a graphical model representing the relationship of the observed image features, the true region labels, and the underlying object contour based on the integration of Markov Random Fields (MRF) and deformable models. We propose two different solutions to this otherwise intractable joint region-contour inference and learning problem in the graphical model. (2) We introduce a Profile Hidden Markov Model (PHMM) built on the shape curvature sequence descriptor to improve the segmentation of specific objects. The special states and structure of PHMMs allow considerable shape contour perturbations and provide efficient inference and learning algorithms for shape modeling. Further embedding of the PHMM parameters captures the long term spatial dependencies on a shape profile, hence the global characteristics of a shape class. (3) We incorporate the proposed methods in a spatio-temporal MRF model to solve the video-based object segmentation problem. Our new model is a simultaneous object segmentation, background modeling, and pose estimation framework, which combines the top-down high-level object shape constraints with the bottom-up low-level image cues, and features a flexible graph structure induced by the motion information for more reliable temporal smoothness. We demonstrate the effectiveness and robustness of all our methods in a wide variety of thorough experiments.
71339510
s2ag/train
v2
2019-03-08T14:22:11.337Z
1970-03-01T00:00:00.000Z
PATHOLOGY OF THE HEART AND BLOOD VESSELS One of the disadvantages of Gram stain is that the final Gram counterstain colours not only the Gram-negative material but also all the other background material in the preparation. A modified technique has been developed to improve colour separation and to eliminate much of the unwanted background Gram-negative stain. The basis of the modification to be described is Preston and Morrell's (1962) Gram staining method. The procedure is as follows: Take the section to water. Take 4 g crystal violet, 40 ml methylated spirit (64 OP), and 160 ml of 1 % ammonium oxalate in water, for 30 to 60 seconds for the ammonium oxalate-crystal violet solution. Rinse briefly in water. Apply Lugol's iodine to the section for 30 to 60 seconds. Pour off the iodine solution and wash the section for 30 seconds in iodineacetone (7 ml liquor iodi fortis and 193 ml acetone) to decolorize. Then counterstain with dilute carbol fuchsin for three minutes. Pour off the excess carbol fuchsin and wash the section in picric acid-cellosolve reagent, from a dropper bottle, for 15 seconds to two minutes to differentiate and counterstain. The picric acid-cellosolve solution, which should be made up freshly at least once a week, is 3 ml 0-6% picric acid to 7 ml csllosolve (2-ethoxy ethanol). After counterstaining blot dry, but do not wash, clear in cedarwood oil (for 10 min), take to xylene in ascending grades of cedarwood oilxylene, and mount in DPX. Although this modification of Gram's method was developed specifically to stain infected tooth tissue it is not limited to this one application. The technique described is in one step and is a rapid extension to the standard Gram stain used in many laboratories. Its use can make the microscopic diagnosis of the presence of Gram-negative forms in smears and tissue sections much easier. In such sections the cell nuclei are stained pink and the cytoplasm a pale orange yellow against a colourless or pale yellow background so that Gram-negative bacteria are easily demonstrated.
52071510
s2ag/train
v2
2018-08-24T21:51:17.524Z
2018-08-01T00:00:00.000Z
When should the driver with a history of substance misuse be allowed to return to the wheel? A review of the substance misuse section of the Australian national guidelines Assessing fitness to drive in applicants with a historical or current substance use disorder presents a specific clinical challenge. The Australian guidelines require evidence of remission and absence of cognitive change when considering applications for re‐licensing driver or individuals applying to reengage in safety‐sensitive work. This paper reviews some of the clinical and biochemical indicators that determine whether a particular person is in ‘remission’ and meets the criteria for return to driving or other safety‐sensitive occupation. It provides an overview of the challenges in establishing an evidence‐based approach to determining fitness for safety critical activities. There is no internationally accepted definition of ‘remission’. Review of the literature and examination of assessment protocols from other national jurisdictions are available for alcohol and the more important drugs of interest in road safety. Assessing fitness to drive when there is a history of substance misuse and/or substance use disorders is a complex issue that requires assessment of biomarkers, clinical findings and clinical assessment before the person returns to driving. We propose that hair testing provides a reliable and reproducible way to demonstrate remission and provide cost‐effective monitoring. Standardised psychological tests could provide a reproducible assessment of the cognitive effects of drug use and suitability to resume driving. We recommend that AustRoads amend the national guidelines to reflect an evidence‐based approach to assessing fitness to drive after conviction for offences related to alcohol and drug use.
136947970
s2ag/train
v2
2019-04-28T13:09:41.441Z
2015-03-01T00:00:00.000Z
Multiscale 3D analysis of creep cavities in AISI type 316 stainless steel Abstract A sample of AISI type 316 stainless steel from a power station steam header, showing reheat cracking, was removed from service and has been examined by a combination of microscale X-ray computed tomography (CT), nanoscale serial section focused ion beam–scanning electron microscopy (FIB-SEM), energy dispersive X-ray (EDX) spectrum imaging and transmission electron microscopy (TEM). Multiscale three-dimensional analysis using correlative tomography allowed key regions to be found and analysed with high resolution techniques. The grain boundary analysed was decorated with micrometre sized, facetted cavities, M23C6 carbides, ferrite and G phase but no σ phase. Smaller intragranular M23C6 particles were also observed, close to the grain boundaries. This intimate coexistence suggests that the secondary phases will control the nucleation and growth of the cavities. Current models of cavitation, based on isolated idealised grain boundary cavities, are oversimplified.
228909520
s2ag/train
v2
2020-11-12T09:05:36.640Z
2020-11-06T00:00:00.000Z
The Struggle for Land and Territory between the Guarani Kaiowá Indigenous People and Agribusiness Farmers on the Brazilian Border with Paraguay: Decolonization, Transit Territory and Multi/Transterritoriality ABSTRACT This article analyzes the struggle for land and territory of the Guarani and Kaiowá peoples and of agribusiness farmers on the border between Brazil and Paraguay. This process results from the territorialization of agribusiness through a privatist logic of spoliation and deterritorialization of which the main victims are the Guarani and Kaiowá peoples who occupied their traditional territories. In this struggle, agribusiness farmers build hegemonic multi/transterritoriality through the corporate use of articulated territories on both sides of the border. The Guarani and Kaiowá peoples elaborate a subaltern multi/transterritoriality as a geostrategy of struggle and resistance for the demarcation of traditional territories.
38249870
s2ag/train
v2
2018-04-03T04:13:55.239Z
1996-01-01T00:00:00.000Z
Pantothenic acid and coenzyme A in experimental cisplatin-induced ototoxia. We have observed that pantothenic acid (PA) prevents deafness induced by cisplatin (CP) in the guinea pig if both drugs are administered jointly. When deafness was previously produced, recovery was sometimes obtained after the administration of PA; so, we studied the effects of PA on cisplatian-induced ototoxia in guinea pigs, both as a prophylactic agent in healthy animals, and as a therapeutic agent in animals previously made deaf by the drug. To elucidate why PA protects the ear from the toxic effects of CP, we used coenzyme A (CoA) instead of PA-since PA is a component of CoA-to test the hypothesis that the action of PA is due to CoA. The results were practically the same in both experiences, the compound action potential of the auditory nerve (CAP) was tested and cochleas were examined by scanning electron microscopy (SEM). Our results suggest that the protective effect of PA takes place through CoA. Both substances had the same effect on CP ototoxicity, but CoA appears to be much more active, since the dose tested here was much lower than that of PA.
120459620
s2ag/train
v2
2019-04-18T13:09:20.613Z
2001-07-01T00:00:00.000Z
Solving nonlinear differential equations having periodic solutions A technique is proposed that permits solving to within 15 or more decimal places, in explicit form, initial value problems for nonlinear ordinary differential equations having oscillatory periodic solutions. The technique is elementary and relies on employing a numerical solver to generate a solution having a high degree of precision, estimating the period of the numerical solution, and then estimating the Fourier series coefficients of the numerical solution. Using the computer algebra system Mathematica, its routine NDSolve
6518070
s2ag/train
v2
2018-04-03T03:31:49.277Z
1997-01-01T00:00:00.000Z
Synthesis of stereoselectively 5'-monodeuterated nucleoside with defined S/R-ratios. An application to the assignment of 5'-methylene signals of DNA oligomers. A method to prepare 5'-monodeuterated nucleosides with various S/R-ratios is described. 5-Oxopentose derivatives synthesized from glucose were converted into 5-monodeuterated pentose derivatives by LiAID4 in the presence of various ligands. The stereoselectivities of the deuteration reactions were investigated under a variety of conditions, and the S/R-ratios of the 5-monodeuterated pentoses varied from 4 : 1 to 1 : 7.4. By mixing these 5-monodeuterated pentose derivatives, we have successfully synthesized thymidine with a defined S/R-ratio at C5'.
153595720
s2ag/train
v2
2016-01-15T18:20:01.362Z
2011-08-22T00:00:00.000Z
Positive Organization Development This article presents a framework for Innovation-inspired Positive Organization Development (IPOD). IPOD is presented as both a radical break from the problem solving approaches that have come to dominate the field, as well as a homecoming to OD’s original affirmative spirit. The converging fields that inform the theory and practice of IPOD are detailed: Appreciative Inquiry, positive organizational scholarship, positive psychology, design theory, and the rise of sustainable enterprises. The theory of change underlying IPOD is articulated, including the three stages in creating strengths-based organizational innovation: 1) the elevation-and-extension of strengths, 2) the broadenand-building of capacity, and 3) the establishment of the new-and-eclipsing of the old. Recent work from the city of Cleveland, Ohio illustrates how these stages unfold. The chapter concludes with an agenda for evolving the field of IPOD, calling for a focus on designing positive institutions that refract and magnify our highest human strengths outward into society.
81059710
s2ag/train
v2
2019-03-18T14:08:41.996Z
2006-03-01T00:00:00.000Z
Nascent Chain Folding of Potassium Channels. Potassium channels are tetrameric membrane proteins that provide a highly selective conduit for K+ ions to diffuse across the hydrophobic barrier of cell membranes. As such, their function is critical for processes like neuronal excitability, secretion of hormones, and muscle contraction. One subset of K+ channels, voltage‐gated (Kv) channels, is exquisitely sensitive to small changes of membrane potential. Although the structure and function of mature Kv channels have been studied extensively, little is known about the early folding events in channel biogenesis. We have developed several biochemical approaches to define the stages and compartments in which secondary, tertiary, and quaternary structures of Kv channels are acquired. The Kv channel contains classical hydrophobic transmembrane segments as well as charged transmembrane segments responsible for sensing voltage. How these diverse segments fold and wend their way through the ribosome, translocon, and beyond, is a mystery. I will discuss nascent peptide folding of Kv cytosolic and transmembrane segments both inside and outside of the ribosomal exit tunnel.
16265860
s2ag/train
v2
2015-12-07T19:30:58.999Z
2004-12-07T00:00:00.000Z
ASIC design of a Kohonen neural network microchip This paper discusses the Kohonen neural network (KNN) processor and its KNN computation engine microchip. The ASIC design of the KNN processor adopts a novel implementation approach whereby the computation of the KNN algorithm is performed on the custom ASIC microchip and its operations are governed by a FPGA based controller. Thus, the ASIC implementation of the KNN processor is derived through integration between a custom ASIC and FPGA. The 3.3V AMI 0.5/spl mu/m C05M-D process technology was used to achieve the VLSI design of the computation engine microchip and the entire design adopted the BBX cell based methodology, which is a viable alternative to conventional ASIC methodology.
199451010
s2ag/train
v2
2019-07-15T22:29:36.928Z
2019-08-02T00:00:00.000Z
Renal damage in primary aldosteronism: a systematic review and meta-analysis. OBJECTIVES In experimental animal models, exogenous aldosterone excess has been linked to the progression of renal disease. However, the evidence of an increased risk of renal damage in patients affected by primary aldosteronism remains controversial. We aimed at evaluating the association between primary aldosteronism and renal damage through a meta-analysis. METHODS We performed a quantitative review of studies evaluating parameters of renal function in patients affected by primary aldosteronism compared with hypertensive patients without primary aldosteronism and in patients affected by primary aldosteronism before and after treatment. We searched MEDLINE, EMBASE, and the Cochrane Central Register of Controlled Trials from January 1960 up to April 2019. RESULTS Forty-six studies including 6056 patients with primary aldosteronism and 9733 patients affected by arterial hypertension without primary aldosteronism were included. After 8.5 years from hypertension diagnosis, patients with primary aldosteronism had an increased estimated glomerular filtration rate (eGFR) compared with hypertensive patients without primary aldosteronism [by 3.37 ml/min IQR (0.82-5.93)] and a more severe albuminuria [standard mean difference 0.55 (0.19-0.91)], resulting into an association with microalbuminuria [odds ratio (OR) 2.09 (1.40; 3.12)] and proteinuria [OR 2.68 (1.89;3.79)]. Following primary aldosteronism treatment, after a median follow-up of 12 months, a reduction in eGFR was observed [by -10.69 ml/min (-13.23; -8.16)], consistent in both medically and surgically treated patients. Similarly, a reduction in albumin excretion and an increase in serum creatinine were observed after treatment. CONCLUSION Patients affected by primary aldosteronism, compared with patients affected by arterial hypertension without primary aldosteronism, display a more pronounced target organ damage, which can be mitigated by the specific treatment.
41149960
s2ag/train
v2
2018-04-03T04:59:55.493Z
1999-01-01T00:00:00.000Z
[Short-stay units depending on Internal Medicine]. BACKGROUND Wetry to establish the utility that a Short Stay Unit depending on Internal Medicine has for a third level hospital. This unit manages the patients under the "appropriate stay" concept. METHODS Several clinical and epidemic variables and sanitary indicators were studied in 867 patients. Cost was measured as the origin by average stays, explorations and readmission. Effectiveness was considered as the percentage of discharges that stay in the hospital for three days or less. RESULTS The average age of the patients was 65.05 years. 55% were males. 82.24% had any previous disease. The most common diagnosis (ICD-9) were respiratory diseases, nervous system diseases and digestive diseases. The average stay of the patients was 57 hours, 2,259 explorations were ordered, it supposes an average of 0.328 urgent explorations and 2,276 UCE explorations. 310 explorations were no received when the patient was sent home. 36.56% of the patients required no explorations. 62.4% of the patients were sent home. Explorations not received had a bad influence in the average stay and in the discharges. Readmissions were 9.36%. CONCLUSIONS We got hay 62.4% of the patients had a stay of 2,375 days in the hospital, With a reasonably low cost in readmissions and explorations. However it wasn't possible to establish which patient coming to the Emergency Service is appropriate for this Short Stay Unit.
237497360
s2ag/train
v2
2021-09-13T21:05:23.310Z
2020-06-01T00:00:00.000Z
Immunomodulatory Efficacy of Phyllanthus Emblica and Costus Speciosus Aqueous Extracts for Immunosuppressive Rats. The immune system helps in eliminating toxic or allergenic substances that enter through mucosal surfaces. The immune system’s ability to mobilize a response to an invading pathogen, toxin or allergen is its ability to distinguish self from non-self. This investigation aimed to study the immunomodulatory efficacy of phyllanthus emblica and costus speciosus aqueous extracts for immunosuppressive rats. Forty two mature male albino rats weighing 150-200 g were used in this work. Rats were divided into 6 equal groups (n=7 rats); one group kept as a control negative, while the rest five groups were once injected intraperitoneally with a single dose (200 mg/kg body weight) of cyclophosphamide for immunosupprission, then devided to five equal groups, one of them left as control positive group (C +ve) while the rest four groups orally ingested with two doses (250 and 500 mg/kg) of phyllanthus emblica and costus speciosus aqueous extracts for each of them. At the end of experimental period (45 days), blood samples were collected and CD4, CD8, CD16 and CD19 were analyzed by flow cytometric El-Sayed H. Bakr and Mona. E.M.Naga 102 analysis. IgM, IgA and IgG were determined using indirect enzymelinked immunosorbent assay (ELISA). The levels of serum albumin and globulin were determined. The obtained results concluded that phyllanthus emblica and costus speciosus enhanced immunomodulatory efficacy by increasing blood levels of CD4, CD8, CD16, CD19, IgM and IgG, moreover, increasing serum levels of albumin and globulins. The group of costus speciosus at a dose of 500 mg/kg. b.wt., declaired the best significant results to boost immunity compared to all experimental groups. The present investigation revealed that Phyllanthus emblica and costus speciosus aqueous extracts possess immunomodulatory efficacy with regard to immunosuppressive animals.
3859160
s2ag/train
v2
2018-03-13T13:22:14.432Z
2017-10-01T00:00:00.000Z
Proposed Bio-authentication System for Question Bank in Learning Management Systems The construction of online exams depends entirely on a pool of questions known as “Question bank” used to form online exams via an adopted learning management systems(LMS). The construction process of a question bank is very sensitive and time-consuming since it requires high skills and practice background of the assigned person. Complexity and expertise are needed to form high level assessments to assure the correct of knowledge transmission and success to acquire the needed knowledge. Previous studies and researches including LMS development progress have aimed only to identify and authenticate students to attempt online exams by merging traditional technologies (username , password) sometimes in combination with fingerprints or face recognition verification mechanisms. This research questions the security level of question bank itself which is considered as backbone of online exams against unwanted acts. We present a mutual design of a Bio-authentication technology of fingerprint of the authorized person as a nested internal security level to access the question bank. We believe it is a novel solution to come over many daily hacking scenarios simply as the case of forgetting the authorized access with high privileges unattended for many reasons which gives a hazardous snap for unwanted users to access the question bank . This novel solution is profoundly emerging fingerprint as data in the internal information security progress of user authentication in case of first level’s (Password/username) busting. This internal security level protects educational process and reflects its sensation for quality assurance purposes.
9650310
s2ag/train
v2
2014-10-01T00:00:00.000Z
2006-11-14T00:00:00.000Z
A New View of the Cosmic Landscape In this scenario, a generic meta-stable deSitter vacuum site in the cosmic landscape in string theory has a very short lifetime. Typically, the smaller is the vacuum energy of a meta-stable site, the longer is its lifetime. This view of the landscape can provide a qualitative dynamical explanation why the dark energy of our universe is so small. The argument for this scenario is based on resonance tunneling, a well-known quantum mechanical phenomenon, the topography of the landscape, and the vastness of the cosmic landscape. Mapping the topography of the landscape, even if only in a small region, will test the validity of this scenario.
154360
s2ag/train
v2
2018-04-03T03:04:01.072Z
2001-07-01T00:00:00.000Z
Flavonoids as cycline-dependent kinase inhibitors: inhibition of cdc 25 phosphatase activity by flavonoids belonging to the quercetin and kaempferol series. In an effort to detect potential inhibitors of cdc25 phosphatase, nineteen flavonoids belonging to the quercetin and kaempferol series have been evaluated, using a colorimetric assay of recombinant human cdc25A tyrosine phosphatase as a cell cycle-specific target. Compounds bearing two benzyl or methyl groups in positions 7 and 4' and acetyl on the hydroxy groups of the sugar moiety showed the maximal activity.
16962610
s2ag/train
v2
2015-02-18T22:23:18.000Z
2012-06-20T00:00:00.000Z
VUV Fourier-transform absorption study of the Lyman and Werner bands in D2. An extensive survey of the D(2) absorption spectrum has been performed with the high-resolution VUV Fourier-transform spectrometer employing synchrotron radiation. The frequency range of 90,000-119,000 cm(-1) covers the full depth of the potential wells of the B (1)Σ(u)(+), B' (1)Σ(u)(+), and C (1)Π(u) electronic states up to the D(1s) + D(2l) dissociation limit. Improved level energies of rovibrational levels have been determined up to respectively v = 51, v = 13, and v = 20. Highest resolution is achieved by probing absorption in a molecular gas jet with slit geometry, as well as in a liquid helium cooled static gas cell, resulting in line widths of ≈0.35 cm(-1). Extended calibration methods are employed to extract line positions of D(2) lines at absolute accuracies of 0.03 cm(-1). The D (1)Π(u) and B'' (1)Σ(u)(+) electronic states correlate with the D(1s) + D(3l]) dissociation limit, but support a few vibrational levels below the second dissociation limit, respectively, v = 0-3 and v = 0-1, and are also included in the presented study. The complete set of resulting level energies is the most comprehensive and accurate data set for D(2). The observations are compared with previous studies, both experimental and theoretical.
56227210
s2ag/train
v2
2018-12-15T09:48:31.007Z
2018-06-30T00:00:00.000Z
Recognition of Weave Patterns of Striped Fabrics Using Optical Coherence Tomography The recognition of woven fabric repeat by conventional techniques is labour intensive. In general, woven fabric repeat identification is accomplished automatically by employing complex algorithms and techniques. These algorithms may, however, occasionally fail, especially when dealing with high complexity texture patterns, structures, figures and colours. Optical coherence tomography (OCT) has the capability of taking high resolution images via contactless measurements. In this paper we apply the spectral domain optical coherence tomography imaging technique for identifying striped woven fabric repeat automatically. OCT scans corresponding to four different fabrics, from which the weave matrixes were recognised, are reported in this study. Automatic identification of weave patterns of striped fabrics was accomplished non-destructively by employing optical coherence tomography.
46812960
s2ag/train
v2
2018-01-09T05:12:42.806Z
1993-01-01T00:00:00.000Z
Interstitial naive and memory T cells in chronic mesangial proliferative glomerulonephritis. Naohiro Yano, MD, Department of Internal Medicine, Tokai University, Isehara, Kanagawa, 259-11 (Japan) Dear Sir, The degree of cell infiltration in the inter-stitium showed direct correlation with the severity of glomerular damage in typical cases of primary glomerulonephritis [1]. However, the role of interstitial infiltrating cells in the progress of glomerulonephritis has not been clarified. A common finding in previous reports [2, 3] is the dominance of CD4-positive helper/inducer T cells in the interstitium. For further analysis of the phenotypes and the roles of interstitial cells, immunohistochemical staining of CD45RA-positive cells, that is, non-antigen-stimulated ‘naive T cells’ and CD45RO-positive cells, that is, antigen-stimulated ‘memory T cells’ [4, 5] in primary chronic mesangial proliferative glomerulonephritis (CGN) using the avidin-biotin complex peroxidase technique was performed. As shown in table 1, we evaluated renal tissues after separating them into two groups, i.e., mild glomerular change group (grade I or II) and moderate to severe change group (grade III or IV). CD45RO-positive memory T cells were the dominant population of interstitial infiltrating T cells (fig. 1). Memory T cells are known as producers of cytokines [5,6]. In order to evaluate the hypothesis that infiltrating T cells produce cytokines, we attempted immunohistochemical peroxidase-alkaliphosphatase double staining using several anticytokine antibodies, but no clear signals indicating memory T cells produced some cytokines could be obtained. A sophisticated technique such as the in situ hybridization method is required to clarify the role of interstitial memory T cells. Acknowledgement This study was supported by a grant from the Japanese Ministry of Health and Welfare.
148151110
s2ag/train
v2
2019-05-09T13:11:05.866Z
2017-01-02T00:00:00.000Z
Girls debating penises, orgasms, masturbation and pornography Abstract This paper presents findings from a study of students’ writings about the erotic. These occurred in the form of graffiti and were scrawled on toilet doors for female students attending a higher education institution in Malta. The study explores how the erotic was defined and perceived by students, and how they attempted to create alternative spaces to explore their erotic selves through their writing. Foucault’s notion of heterotopia, which refers to spaces enacted for the Other, informs the analysis. Heterotopias subvert the order of spaces and mirror other dominant sites that make up the social fabric. This framework considers the lavatories as heterotopias, through which students broke silences and taboos about the erotic by challenging perspectives concerning sexual relatedness and erotic fantasy. In the absence of sexuality education in the curriculum of the institution in which the study took place, the study suggests that students may have sought out and constructed new ways of learning.
219467810
s2ag/train
v2
2020-05-28T09:12:19.573Z
2020-05-18T00:00:00.000Z
Drivers of change in the epifaunal assemblages associated with intertidal macro-algae at the Mangrove site south Safaga, Egypt, Red Sea The Red Sea is characterized by the presence of more than one ecosystem within its coastal areas. These ecosystems included the most famous coral reef, sea grass, and mangrove in addition to sandy and rocky beaches (El-Nagar et al., 2017). Among all these different types of ecosystems and habitats, a vast number of marine species were found to be associated with a single and/or multiple habitats. The most repeated habitat ARTICLE INFO ABSTRACT Article History: Received: May 03, 2020 Accepted: May 15, 2020 Online: May 18, 2020 _______________
196113810
s2ag/train
v2
2019-02-17T14:19:28.314Z
2018-05-03T00:00:00.000Z
Artificial Human Optimization - An Introduction The goal of this article is : 1) To popularize "Artificial Human Optimization" field 2) To show opportunities that exist in "Artificial Human Optimization" field. 3) To Design an optimization method based on Artificial Humans 4) To show reviews of papers in “Artificial Human Optimization” field 5) To make corrections to my previews work in “Artificial Human Optimization” field 6) To encourage researchers across the globe to work in “Artificial Human Optimization” field 7) To give Artificial Human Optimization award to researchers who contributed to this new field
35042060
s2ag/train
v2
2018-04-03T02:47:13.543Z
1996-11-01T00:00:00.000Z
Secondary structure, membrane localization, and coassembly within phospholipid membranes of synthetic segments derived from the N‐ and C‐termini regions of the ROMK1 K+ channel The hydropathy plot of the inwardly rectifying ROMK1 K+ channel, which reveals two transmembrane and a pore region domains, also reveals areas of intermediate hydrophobicity in the N terminus (M0) and in the C terminus (post‐M2). Peptides that correspond to M0, post‐M2, and a control peptide, pre‐M0, were synthesized and characterized for their structure, affinity to phospholipid membranes, organizational state in membranes, and ability to self‐assemble and coassemble in the membrane‐bound state. CD spectroscopy revealed that both M0 and post‐M2 adopt highly α‐helical structures in 1% SDS and 40% TFE/water, whereas pre‐M0 is not α‐helical in either 1% SDS or 40% TFE/water. Binding experiments with NBD‐labeled peptides demonstrated that both M0 and post‐M2, but not pre‐M0, bind to zwitterionic phospholipid membranes with partition coefficients of 103–105 M−1. A surface localization for both post‐M2 and M0 was indicated by NBD shift, tryptophan quenching experiments with brominated phospholipids, and enzymatic cleavage. Resonance energy transfer measurements between fluorescently labeled pairs of donor (NBD)/acceptor (rhodamine) peptides revealed that M0 and post‐M2 can coassemble in their membrane‐bound state, but cannot self‐associate when membrane‐bound. The results are in agreement with recent data indicating that amino acids in the carboxy terminus of inwardly rectifying K+ channels have a major role in specifying the pore properties of the channels (Taglialatela M, Wible BA, Caporaso R, Brown AM, 1994, Science 264:844–847; Pessia M, Bond CT, Kavanaugh MP, Adelman JP, 1995, Neuron 14:1039–1045). The relevance of the results presented herein to the suggested model for the structure of the ROMK1 channel and to general aspects of molecular recognition between membrane‐bound polypeptides are also discussed.
248809210
s2ag/train
v2
2022-05-16T19:08:18.272Z
2022-05-16T00:00:00.000Z
Outcome of complex surgical resection and reconstruction for rare thoracic cancers: the clinical value of a predictive score Background. Complex surgical resection and reconstruction for rare thoracic cancers (RTCs) represent a major challenge, given their very low frequency, extreme variability of presentation, multi-modality treatment options and inadequate outcome prediction. We reported the experience of a tertiary referral centre on a consecutive series of RTC patients, to predict outcome by disease and complexity of surgical procedures. Methods. From Jan 2003 to Dec 2018, 1122 surgical procedures were performed with curative intent on 952 RTC patients. Study endpoints were: post-operative hospital stay (Pod), 30-day and 90-day mortality, 5-year and 10-year survival (OS). The follow-up was closed at June 2020. Results. Median Pod was 8 days, with a 2% 30-day and 3.9% 90-day mortality. Overall survival (OS) was 85.7% at 1 year, 61.7% at 5 years and 50.7% at 10 years. Ten-year OS was 64.8% in low, 58.8% in intermediate, and 42.4% in high complexity score (Log-rank tests p<0.0001); 64.4% in patients with 1 or 2 reconstructions and 32.8% in patients with 3 or more reconstructions; 44.5% with vascular and 48% with chest wall reconstruction; 71.8% in germ cell tumors and 0% in mesothelioma. Conclusion. Complex surgical resection and reconstruction was associated with acceptable 90-day mortality and good 10-year survival in all RTCs but mesothelioma. A predictive score based on surgical complexity and cancer type can help the clinical decision making.
236369360
s2ag/train
v2
2021-07-27T00:04:43.717Z
2021-06-01T00:00:00.000Z
Roundtable discussion: Organising cleaners in the context of Covid-19 People working as cleaners represent a substantial part of the modern British working class. Low-paid, often part-time, disproportionately female and, more recently, from black and minority ethnic and migrant communities, this workforce has historically been seen as hard to organise. Yet the Covid-19 crisis has elevated the status of cleaning as a key part of maintaining public health. In this article, trade union organisers with experience of working with cleaners discuss the possibilities of the current conjuncture for effecting a step change in both unionisation and the reconstruction of public services.
46316510
s2ag/train
v2
2018-04-03T06:17:59.042Z
1998-10-01T00:00:00.000Z
Cell surface density of p185(c-erbB-2) determines susceptibility to anti-p185(c-erbB-2)-ricin A chain (RTA) immunotoxin therapy alone and in combination with anti-p170(EGFR)-RTA in ovarian cancer cells. Approximately 30% of ovarian and breast cancers overexpress p185(c-erbB-2) with as many as 10(6) receptors/cell. Normal cells have as few as 10(4) receptors/cell. We have examined the susceptibility of SKOv3 human ovarian cancer cells to anti-c-erbB2 antibodies and immunotoxins as a function of c-erbB-2 density on the cell surface. A panel of SKOv3 clones that expressed different densities of p185(c-erbB-2) receptor were generated through transfection with the c-erbB-2 gene. A significant correlation was found between p185(c-erbB-2) density and susceptibility to killing by anti-p185(c-erbB-2)-ricin A chain (anti-p185(c-erbB-2)-RTA) immunotoxins. With 10(5) copies/cell of p185(c-erbB-2), <10% of clonogenic ovarian cancer cells could be eliminated, whereas in clones that expressed 10(6) copies/cell of p185(c-erbB-2), 99.9% of clonogenic tumor cells were killed. In cell lines that overexpressed p185(c-erbB-2) and also expressed p170(EGFR), anti-p185(cerbB-2)-RTA and anti-p170(EGFR)-RTA immunotoxins exerted synergistic cytotoxicity. Treatment with the two immunotoxins could eliminate 99.99% of clonogenic cells. Importantly, tumor cells that had survived first treatment with anti-p185(c-erbB2)-RTA alone still retained sensitivity to repeat treatment with the same immunotoxin and also proved susceptible to the synergistic cytotoxicity of anti-p185(cerbB-2)-RTA in combination with anti-p170(EGFR)-RTA. Growth characteristics of the clones expressing various levels of p185(c-erbB-2) were also studied. No correlation was found between p185(c-erbB-2) expression levels and the rate of anchorage-dependent growth, anchorage-independent growth, or in vivo growth in nude mice.
34168910
s2ag/train
v2
2018-04-03T02:34:28.330Z
2014-12-01T00:00:00.000Z
Cerebral vasculitis in rheumatoid arthritis. This case is of a 52-year-old lady, who presented with a 7-day history of headache associated with nausea and vomiting. On physical examination, she was apyrexial, and neurological examination was unremarkable. She had a history of seropositive rheumatoid arthritis diagnosed 20 years previously. During this time, she had been treated with multiple anti-rheumatic drugs, including Gold, Sulphasalazine, Methotrexate, Penicillamine and Leflunomide, in addition to several arthroplasties and arthrodeses. No extra-articular manifestations of rheumatoid disease were documented since diagnosis. Laboratory investigations on admission showed haemoglobin of 135 g/l, white cell count of 9.7 × 109/l, platelets of 171 × 109/l, C-reactive protein of <5 mg/l and erythrocyte sedimentation rate of 36 mm/h. A CT scan of her head was reported as a normal unenhanced CT brain (Figure 1A), with no focal infarct or haemorrhage. She was discharged home the following day, her headache improved, the provisional diagnosis being migraine. She re-presented 7 days later with the same three symptoms of headache, nausea and vomiting, in addition to a new right visual field defect, ataxia and expressive dysphasia. A further CT scan revealed appearances consistent with left occipital infarction (Figure 1B). High-dose oral glucocorticoids (1 mg/kg) were commenced as it was felt that temporal arteritis could not be excluded clinically. Seven days later, and with no clinical improvement, she suffered a recurrence of symptoms with sudden onset of left-sided weakness, left visual field defect and confusion. CT scanning revealed multiple large, new right parieto-occipital, right high …
15047760
s2ag/train
v2
2015-03-06T19:42:58.000Z
2001-01-01T00:00:00.000Z
The Unipolar Dynamotor: A Genuine Relational Engine We describe two quasi trivial, “old fashioned” [1], but cleverly conceived, undisputable, experiments which disprove Kennard-type absolutistic interpretations of unipolar machines [2,3]. Our findings are in agreement with Weber’s statements concerning the role of relative motion in electrodynamics [4], as advanced by himself towards the middle of the 19 century. And also we agree with Mach’s views concerning motion at the most general level [5]. This work settles our earlier contributions devoted to unipolar induction [6,7]. “For nearly a century after its discovery by Faraday in 1832 the unipolar generator was a conundrum for the theory of electromagnetism”-D.F. Bartlett et al. Phys. Rev D 16 (12), 3459 (1977). “We are to admit no more causes of natural things than such as are both true and sufficient to explain their appearances ”. Isaac Newton.
45701010
s2ag/train
v2
2018-04-03T06:07:54.678Z
1993-04-01T00:00:00.000Z
The effect of light on core body temperature is mediated by melatonin in women. Acute exposure to bright light at night reduces the nocturnal decline of core body temperature (cBT) and inhibits melatonin secretion in men. Since inhibition of melatonin secretion by beta-adrenergic blockade reduces the nocturnal decline of cBT by 40% in women, experiments were performed to investigate whether the thermoregulatory effect of light is mediated by modifications of melatonin secretion in cycling women. Results show that the elevation of cBT induced by nocturnal exposure to bright light (3000 lux) can be reversed completely by circumventing the decline of serum melatonin levels with concurrent oral administration of melatonin. Our finding establishes melatonin as the mediator of the effect of light on cBT in women and provides a rationale for the use of orally administered melatonin as an aid in the reentrainment of the cBT rhythm in desynchronized conditions.
232367210
s2ag/train
v2
2021-03-27T06:16:36.957Z
2021-03-01T00:00:00.000Z
The Regulation and Governance of Clinical Trials: Past and Present Considerations to Ensure Ethical Treatment of Human Participants. Clinical trials are crucial in determining whether novel medical interventions are effective and safe. The use of human participants in such trials is also vital, as animal testing and computer simulation are no substitutes for testing people. Regulation aimed to ensure ethical and safe practices when using human participants, had its beginnings at a global level in response to World War II atrocities. Since that time, there has been an exponential rise of clinical trials, driven mostly by large pharmaceutical companies and for-profit contract research organisations motivated to find preventions and cures for illness and disease, and profit. In turn, there is an ever-growing demand for clinical trial human participants. This article considers historical and contemporary instances of when such trials have gone wrong, and examines the development, and importance of comprehensive, robust, and responsive regulation and governance of clinical trials at both international and domestic levels of which researchers must be aware.
247163210
s2ag/train
v2
2022-03-01T16:08:10.075Z
2022-02-27T00:00:00.000Z
Adoption of biofuels for marine shipping decarbonization: A long‐term price and scalability assessment This study assessed the long‐term annual biofuel production capacity potential and price in the United States and shed light on the prospect of biofuel adoption for marine propulsion. A linear programming model was developed to assist the projections and provide insightful analyses. The projected long‐term (2040) maximum annual capacity of biofuels in the United States is 245 million metric tons (Mt) or 65 billion gallons of heavy fuel oil gallon equivalent (HFOGE) when based on the median feedstock availability. Between 2022 (near‐term) and 2040, the potential biofuel capacity increases by over 40%, attributed to increased feedstock availability. At a price range up to $500/t, biodiesel is the main product, and the annual capacity (12 Mt) is limited to feedstock availability constraints. Biodiesel and corn ethanol are the main biofuels at a price range up to $750/t. At a higher price point (above $750/t), the biofuel types and annual capacities increase substantially (218 Mt per year). Biofuels above this price include gasoline‐, jet‐, and diesel‐range blendstocks, as well as bio‐methanol, bio‐propane, and biogas. This study concludes that the US domestic feedstock availability coupled with advanced conversion technologies can produce substantial amounts of biofuels to achieve a critical mass and be impactful as alternative marine fuels. There is also a need to improve the biofuel price for marine shipping adoption. Policies and economic incentives that provide temporary financial support would help facilitate maritime biofuel adoption. © 2022 Alliance for Sustainable Energy, LLC. Biofuels, Bioproducts and Biorefining published by Society of Industrial Chemistry and John Wiley & Sons Ltd.
205080260
s2ag/train
v2
2018-04-03T04:11:34.966Z
2016-12-28T00:00:00.000Z
Safety of Nonsteroidal Antiinflammatory Drugs. Nonsteroidal antiinflammatory drugs (NSAIDs), one of the most widely used classes of drugs in the world, are effective antiinflammatory, analgesic, and antipyretic agents. Although they differ from one another in chemical class, all inhibit the synthesis of prostaglandins. Because prostaglandins serve a variety of physiological functions in organs throughout the body, NSAIDs frequently have side effects. For example, prostaglandins contribute to the protective barrier that prevents ulcerations in the mucosa of the stomach, and they are also critical in maintaining renal and gastromucosal perfusion when they are threatened. Thus, NSAIDs can increase the risk of gastric ulcers and of usually . . .
108714060
s2ag/train
v2
2019-04-12T13:58:02.862Z
1982-03-12T00:00:00.000Z
Thermoelectric (TE) Cooled Sensors For Thermographic Instruments This paper presents a compilation of information on the history and features of thermo-electric coolers, infrared detectors and their combination into detector/cooler packages. It shows their potential for utilization as the thermal infrared sensors in those measurement devices related to the problems of energy conservation in building envelopes. General sensor considerations are reviewed in light of present and future applications and features of a typical commercial instrument using thermoelectrically cooled detectors are presented. The history, evolution and features of the cooler detector package, which is the heart of the system is presented. The presentation highlights the desirable attributes of these often overlooked thermoelectrically cooled detectors. Features such as low cost, high reliability, low power, lightweight and long life make them more appreciated and attractive to future commercial instrumentation designs.
19679360
s2ag/train
v2
2018-04-03T05:35:58.486Z
1994-03-01T00:00:00.000Z
Alkaline hydrolysis of cefotaxime. A HPLC and 1H NMR study. A kinetic study on the alkaline hydrolysis of cefotaxime at pH 10.5 and 37 degrees C has been carried out by using HPLC and 1H NMR. The main resulting degradation products have been isolated and identified. These include, apart from the well-known deacetylcefotaxime, the exocyclic methylene derivative, the 7-epimer of cefotaxime and the 7-epimer of deacetylcefotaxime. The kinetic constants involved in the process have been determined and according to the experimental results the attack of the hydroxyl group on the ester function bonded to the 3'-carbon is the fastest step in the proposed kinetic scheme. It should be emphasized that the base-catalyzed epimerization of the hydrogen at the 7 position clearly depends on the presence of a good electron-withdrawing group at C(3'). On the other hand, no hydrolysis of the amide at position 7 was detected.
53569510
s2ag/train
v2
2018-11-19T16:24:29.042Z
2018-12-01T00:00:00.000Z
Mouse Magnetic-field Nystagmus in Strong Static Magnetic Fields Is Dependent on the Presence of Nox3. HYPOTHESIS Magnetic vestibular stimulation (MVS) elicits nystagmus in C57BL/6J mice but not head tilt mice lacking Nox3, which is required for normal otoconial development. BACKGROUND Humans have vertigo and nystagmus in strong magnetic fields within magnetic resonance imaging machines. The hypothesized mechanism is a Lorentz force driven by electrical current entering the utricular neuroepithelium, acting indirectly on crista hair cells via endolymph movement deflecting cupulae. We tested an alternate hypothesized mechanism: Lorentz action directly on crista hair cell stereocilia, driven by their currents independent of the utricle. METHODS Before MVS, vestibulo-ocular reflex responses of eight C57BL/6J mice and six head tilt mice were measured during whole-body sinusoidal rotations and tilts using video-oculography. Mice were then placed within a 4.7 Tesla magnetic field with the horizontal semicircular canals approximately Earth-horizontal for ≥1 minute in several head orientations, while eye movements were recorded via infrared video in darkness. RESULTS Outside the magnet, both C57BL/6J and head tilt mice had intact horizontal vestibulo-ocular reflex, but only C57BL/6J mice exhibited static counter-roll responses to tilt (normal utiruclo-ocular reflex). When placed in the magnet nose-first, C57BL/6J mice had left-beating nystagmus, lasting a median of 32.8 seconds. When tail-first, nystagmus was right-beating and similar duration (median 28.0 s, p > 0.05). In contrast, head tilt mice lacked magnetic field-induced nystagmus (p < 0.001). CONCLUSIONS C57BL/6J mice generate nystagmus in response to MVS, while mice deficient in Nox3 do not. This suggests 1) a normal utricle is necessary, and 2) functioning semicircular canals are insufficient, to generate MVS-induced nystagmus in mice.
15475760
s2ag/train
v2
2014-10-01T00:00:00.000Z
2007-09-01T00:00:00.000Z
Universal Bufferless Packet Switching A packet-switching algorithm specifies the actions of the nodes in order to deliver packets in the network. A packet-switching algorithm is universal if it applies to any network topology and for any batch communication problem on the network. A long-standing open problem has concerned the existence of a universal packet-switching algorithm with near-optimal performance guarantees for the class of bufferless networks where the buffer size for packets in transit is zero. We give a positive answer to this question. In particular, we give a universal bufferless algorithm which is within a polylogarithmic factor from optimal for arbitrary batch problems: ${\cal T}=O\left({\cal T}^*\cdot \log^3(n+N)\right)$, where ${\cal T}$ is the packet delivery time of our algorithm, ${\cal T}^*$ is the optimal delivery time, n is the size of the network, and $N$ is the number of packets. At the heart of our result is a new deterministic technique for constructing a universal bufferless algorithm by emulating a store-and-forward algorithm on a transformation of the network. The main idea is to replace packet buffering in the transformed network with packet circulation in regions of the original network. The cost of the emulation on the packet delivery time is proportional to the buffer sizes used by the store-and-forward algorithm. We obtain the advertised result by using a store-and-forward algorithm with logarithmic sized buffers. The resulting bufferless algorithm is constructive and can be implemented in a distributed way.
44346510
s2ag/train
v2
2018-04-03T05:43:40.915Z
1993-02-01T00:00:00.000Z
The effect of DAU 6215, a novel 5HT-3 antagonist, in animal models of anxiety. The aim of the present study was to evaluate the effect of DAU 6215 (N-(endo-8-methyl-8-azabicyclo[3.2.1]oct-3-yl)-2, 3-dihydro-2-oxo-1H-benzimidazol-1-carboxamide, hydrochloride), which is a 5HT-3 receptor antagonist, chemically different from the other 5HT-3 antagonists, on a wide variety of animal models sensitive to anxiolytics. Nine animal models were used. DAU 6215 was active in reducing (i) aversion to a brightly lit environment in the light/dark exploratory test in mice, (ii) unpleasant properties of an aversive drug in rats (naloxone-induced place aversion), and (iii) aggressiveness in monkeys. DAU 6215 was effective at doses ranging (a) between 10 and 1000 micrograms/kg given i.p. in mice, (b) between 15 and 30 micrograms/kg given s.c. in rats and (c) between 1 and 10 micrograms/kg given orally in monkeys. DAU 6215 was inactive in (iv) the elevated plus maze, (v) conflict test and (vi) emotional hypophagia in rats and in (vii) the four plates test, (viii) staircase test and (ix) stress-induced hyperthermia in mice. Diazepam was active in all tests. In contrast to diazepam, DAU 6215 did not induce place preference, suggesting the possible lack of addictive properties.