Datasets:

nickypro

/

minipile

like 0

Introduction {#s01} ============ MicroRNAs (miRNAs) are small, noncoding RNAs that post-transcriptionally regulate mRNA expression by binding to the 3'UTR of protein-coding genes. As such, miRNAs are thought to be key regulators in carcinogenesis. MiRNAs were first reported as being associated with colorectal cancer (CRC) in 2003^[@b1]^. Since then, research focusing on miRNAs has expanded rapidly, in the number of studies, the miRNAs examined, and the types of studies conducted. Studies that focus on few miRNAs and those that have undertaken large-scale discovery have identified hundreds of dysregulated miRNAs in CRC. However, findings are not unanimous as to which miRNAs are dysregulated in CRC nor is there a universal point at which miRNAs are considered dysregulated. Statistically significant associations have unknown biological significance when a fold change (FC) difference between carcinoma and normal mucosa is minimal (for instance a FC of 1.1). Correspondingly, the level of expression change between carcinoma and normal mucosa that is needed to have a biological significance is unknown, however setting some threshold for meaningful differences, such as a 50% or twofold change, when considering important miRNAs for determining functionality, could help avoid considering small changes that stem from noise in the data. Determining important miRNAs can be difficult, since results can vary by type of study, which range from population-based epidemiologic approaches to those using cell lines to evaluate the influence of specific miRNAs. Small studies of targeted miRNAs can identifiy "statistically significant" miRNAs that would not hold the same level of significance after adjustment for multiple comparisons of all miRNAs conducted in large discovery studies. We have previously addressed some of the issues surrounding studying miRNAs in terms of measurement of miRNA expression, standardizing miRNA expression, and using existing databases to determine target genes^[@b2],[@b3]^. The utilization of individually paired-carcinoma and normal mucosa is important when determining differential expression as well as the impact of miRNA expression on disease and prognosis^[@b4]^. As we have previously reported, repeat sampling of study data shows considerable variation in results when looking only at absolute miRNA expression in carcinomas or if using non-paired normal mucosa expression data, while much greater consistency in findings occurrs when differential expression is calculated from individually paired carcinomas and normal mucosa samples^[@b4],[@b5]^. We have shown that diet, alcohol, and smoking are associated with miRNA expression, as are genetic variants^[@b6]-[@b10]^. MiR-17-5p, miR-106b-5p, miR-19b-3p, and miR-20b-5p were downregulated in smokers; miR-106b-5p, miR-145-5p, and miR-17-5p were downregualted in subjects who consumed wine; and miR-145-5p was positively associated with whole grain intake. Individually paired tissue samples control for confounding factors, either genetic or environmental, that may influence miRNA expression. Using paired data also can help overcome variance in differential miRNA expression derived from tissue processing, since an individual's carcinoma and normal mucosa tissues are processed in the same manner. However, given the additional cost and availability of samples, individually paired analysis is often not undertaken, contributing to greater difficulty in determining important miRNAs. The biggest obstacle in advancing miRNA into translational research is determining how miRNAs impact biological pathways and disease processes. It is well known that miRNAs regulate many genes and many genes are regulated by multiple miRNAs. These co-regulatory networks of genes and miRNAs complicate our understanding of functionality and bring into question the importance of pursuing a single miRNA as a therapeutic target without understanding the broader complex in which it belongs. Our goal in this paper is to summarize key findings from our large epidemiological study of miRNAs in CRC. This study was conducted both as a means of discovering new potentially important miRNAs as well as replicating previously reported miRNAs that were associated with CRC; we believe this summary can help focus further research. Additionally, consolidating our study findings may highlight which miRNAs will serve as the best therapeutic targets, either individually, or in groups. We believe that information gained from our large study of 1,954 individuals diagnosed with CRC, who have paired carcinoma and normal mucosa miRNA expression data on over 2,000 miRNAs (Agilent Human miRNA Microarray V19.0) allows for cohesive and comprehensive insight into miRNAs as they relate to CRC. Of the 1,954 individuals included in this study, 1,855 of these individuals had information on survival and 217 of the 1,954 individuals had paired carcinoma and normal gene expression data obtained from RNAseq data. Differentially expressed miRNAs in CRC {#s02} ====================================== In order for an miRNA to be functionally important in CRC, it is assumed that they have to be dysregulated in CRC tumors compared to normal mucosa. Of the 2,006 miRNAs analyzed in our study, 63.7% were expressed in carcinoma tissue and 63.26% were expressed in normal mucosa^[@b3]^. Of those miRNAs expressed in over 80% of the population (598 miRNAs), 86% of these miRNAs were statistically significantly (adjusted *P* value \< 0.05) differentially expressed between carcinoma and normal mucosa. However, of those significantly and differentially expressed, 45 miRNAs (8.7%) had a FC of \> 1.50 or \< 0.68 ^[@b3]^. The level of FC that is biologically important is not clear and it should be recognized that utilization of FC as a tool to identify important miRNAs also has limitations, one being that if there are low levels of miRNA expression a large FC can be detected. Furthermore, calculation of FC is difficult when the miRNA is not expressed in either the carcinoma or normal mucosa. Identification of miRNAs that may have the greatest functional significance when most miRNAs are "dysregulated" can be challenging. In our study, we utilized a random forest technique that allowed us to identify a subset of these miRNAs that best distinguished differences in miRNA expression between carcinoma and normal mucosa^[@b11]^. Using this statistical method we identified 16 miRNAs important in colon cancer and 17 miRNAs important in rectal cancer (**[Table 1](#Table1){ref-type="table"}**); four miRNAs were uniquely associated with colon cancer (miR-663a, miR-4538, miR-215, and miR-192-5p) and five miRNAs were uniquely associated with rectal cancer (miR-4323, miR-150-5p, miR-4749-3p, miR-424-3p, and miR-6073)^[@b11]^. Three of the miRNAs identified in colon cancer had a FC of \> 0.67 (miR-4538 FC 0.73, miR-378a-3p FC 0.75, and miR-378i FC 0.76) and two of the miRNAs identified in rectal cancer had a FC of \> 0.67 (miR-378i FC 0.76 and miR-378a-3p FC 0.74); these miRNAs may not have been considered important if a strict FC cutpoint had been applied. These miRNAs (shown in **[Table 1](#Table1){ref-type="table"}** in numerical order) are one set of miRNAs that appear to predict differential expression when considered together. However, given the number of dysregulated miRNAs in CRC, it is highly probable that other miRNAs also have functional significance. ###### Summary of miRNAs identified as being important in CRC based on random forest assessment ----------------------- ------------------------------------------------------------------------------------------------------------------------- Down-regulated miRNAs MiR-145-5p, miR-150-5p, miR-192-5p, miR-215, miR-378a-3p, miR-378i, miR-4323, miR-4538, miR-4539, miR-4749-3p, miR-6073 Up-regulated miRNAs MiR-17-59, miR-20a-5p, miR-21-5p, miR-3651, miR-424-3p, miR-4506, miR-663a, miR-663b, miR-92a-3p, miR-93-5p ----------------------- ------------------------------------------------------------------------------------------------------------------------- While at the population level miRNAs are up-regulated, down-regulated, or not dysregulated when comparing carcinoma tissue to normal mucosa; it should be kept in mind that not all individuals in the population have the up-regulated or down-regulated miRNA in their carcinoma tissue. However, our data suggest that miRNAs appear to be more stable than mRNAs when considering the percentage of the population with a dysregulated miRNA compared to a dysregulated mRNA^[@b12]^. Additionally, those miRNAs with a higher FC appear to have a greater percentage of the population with a dysregulated miRNA. The set of miRNAs identified by our random forest analysis were, for the most part, highly dysregulated, making them targets that have an application at the population level. Knowing that dysregulated miRNAs with smaller FCs may be dysregulated in a smaller subset of the population also suggests the importance of focusing on higher FC in miRNA expression when determining which miRNAs to target for further functionality studies. Infrequently expressed miRNAs {#s03} ============================= In our data, 38.79% of miRNAs were expressed in less than 20% of colorectal carcinomas (498 miRNAs) and 36.11% of miRNAs (457 miRNAs) were infrequently expressed in normal mucosa^[@b3]^. A reasonable question is, are these infrequently expressed miRNAs of biological importance or are they merely noise in the data? Given our large sample size we were able to examine in more detail infrequently expressed miRNA. Our approach to this question was to focus on those miRNAs that were infrequently expressed, but when expressed had higher levels of expression; what we hoped was beyond "noise" in the data. Our data suggest that infrequently expressed miRNAs may be important in defining tumor phenotype^[@b13]^ and survival after a diagnosis with colorectal cancer^[@b14]^. **[Table 2](#Table2){ref-type="table"}** summarizes those miRNAs that may have a functional signficiance because they influence survival, mainly when up-regulated in the tumor. In most instances, having these miRNAs up-regulated in tumors resulted in worse survival. While we do not understand how these miRNAs function, their association with survival implies that they may have a functional significance in the carcinogenic process. ###### Infrequently expressed miRNAs that may influence survival in CRC Improved survival Worse survival ------------------------------------ ---------------------------------------------- --------------------------------------------------------------------------------------------------------------------------------------------------- Up-regulated in carcinoma tissue MiR-347a-5p, miR-590-5p, miR-362-5p, miR-632 MiR-124-3p, miR-143-5p, miR-145-3p, miR-31-5p, miR-99b-5p, miR-1, miR-124-3p, miR-133a, miR-143-5p, miR-3622b-3p, miR-378g, miR-548aw, miR-371-3p Down-regulated in carcinoma tissue MiR-645 Determining functionality {#s04} ========================= MiRNAs are key regulators of gene expression, hence they are important to the carcinogenic process. An initial step in determining biological impact is to identify which genes are targeted by various miRNAs. Methods such as Western blot and reporter assays measure protein expression levels, an important consideration given that miRNAs are thought to work post-transcriptionally. However, most databases such as miRTarBase, have incorporated miRNA target gene data that are based on less strong evidence of associations such as microarray, RNASeq, and Northern blot^[@b15]^. While these methods don't validate miRNA targets using protein expression and instead measure gene expression, several studies have shown that, despite miRNAs having their impact post-transcriptionally, they usually also alter gene expression^[@b16],[@b17]^. Given that databases are restricted to existing literature and that the literature does not uniformly represent all miRNAs^[@b2]^, we utilized RNASeq gene expression data to gain insight into miRNAs associated with gene expression. By examining how change in miRNA expression was associated with change in mRNA expression we gained insight into potentially important miRNAs and their targeted genes. **[Figure 1](#Figure1){ref-type="fig"}** provides an example of how these differences are correlated (beta coefficient -0.30). {#Figure1} Seed-region matches between the miRNA and the 3'UTR of the mRNA suggest a greater propensity for binding and therefore an increased likelihood that the miRNA directly influences mRNA expression; previously we investigated miRNA and mRNA FASTA sequences for matches of 6, 7, and 8 contiguous nucleotides to elucidate direct interactions, in which mRNA expression is reduced^[@b18]^. Thus, looking at seed region matches between miRNA and mRNA is one method to identify potentially important target genes for an miRNA. However, it has been suggested that other factors, such as binding at energy-based sites, may be important when identifying target genes. Ding and colleagues^[@b19]^ used energy-based sites as a second set of criteria when identifying candidate target sites; seed-region matching remained the first line of candidate site identification. It has been suggested that as much as 16% of miRNA:mRNA interactions may not involve contacts within seed regions and are considered seedless interactions^[@b20]^. In our studies, we used seed-region matching to provide additional information on our miRNA-mRNA associations, which, taken together with a negative beta coefficient between the two, provides additional support for their direct binding. A negative beta coefficient combined with the identification of a seed region match suggests that, as the miRNA binds to the mRNA, it decreases the mRNA expression. Because we only looked at seed matching, we did not consider seedless interactions. We believe that looking at seed-region matches between miRNA and mRNA provides support that miRNAs are targeting specific genes that may be important in CRC. While direct binding between an miRNA and an mRNA shows support for that gene being a target of the miRNA, indirect associations between miRNAs and mRNAs also have potential biological importance. Indirect associations are seen in our studies when the differential expression of an miRNA is statistically significantly associated with the differential expression of an mRNA, but as one increases the other increases, or they are inversely associated but without a seed-region match. Indirect effects most likely occurr in feed-forward loops^[@b21]-[@b23]^. In feed-forward loops, regulators such as miRNAs can have either the same effect (repression of expression) or opposite effects on each other^[@b22]^. In feed-forward loops, a transcription factor (TF) such as *TP53* can regulate the miRNA and the target gene (TG), which in turn is regulated by the miRNA. The miRNA may regulate the TG directly, through seed region binding, leading to mRNA degradation or translational repression, or indirectly, through repression of the TF that is influencing transcription of the same TG. Studies suggest that regulatory pathways involving miRNAs are prevalent mechanisms of altering gene expression^[@b22]^. Tumor suppressor genes (TSG) and oncogenes (OG) play important roles in the carcinogenic process by controlling cell growth and inhibiting tumor formation. MiRNAs are thought to play similar roles in the carcinogenic process and it has been suggested that they work with OGs and TSGs^[@b24]^. Determining the association between miRNAs and TSGs and OGs is another avenue in which to pursue insight into miRNA functionality. In our data, we observed that miRNAs most likely have both direct and indirect effects on TSGs and OGs^[@b25]^, suggesting that they work as intermediary regulators between OGs and TSGs, and help balance up and down regulation of genes that in turn influence cell proliferation and apoptosis. Looking at the associated miRNAs, TSGs and OGs suggests that miRNA dysregulation in key signaling pathways is important to CRC^[@b25]^. Increased inflammation, angiogenesis, and decreased immune response are hallmarks of many of the major pathways in which dysregulated TSGs and OGs operate with miRNAs. A comprehensive evaluation of all genes within these pathways, in conjunction with all miRNAs expressed in CRC, provided further insight into functionality of miRNAs and possible target sites for intervention. Key pathways assessed with miRNAs were: apoptosis^[@b26]^, cell cycle^[@b27]^, JAK-STAT signaling^[@b28]^, MAPK signaling^[@b29]^, NFκB signaling^[@b30]^, PI3K/AKT^[@b31]^, TGFβ signaling^[@b12]^ , p53 signaling^[@b32]^, and Wnt signaling pathways^[@b33]^. Focusing on the those miRNAs (triangle shape) identified through random forrest analysis with an miRNA: mRNA seed region match (mRNAs designated by square shape), one can see how the same miRNA is associated with multiple genes in multiple pathways, and the same is true for mRNAs (**[Figure 2](#Figure2){ref-type="fig"}**); **[Supplementary Table S2](#TableS2){ref-type="table"}** shows mRNAs and miRNAs in more detail. Likewise, mRNAs are associated with multiple miRNAs in different pathways. {#Figure2} Further evaluation of the miRNA:mRNA associations within these nine pathways shows that 88 of the 814 miRNAs (10.8%) expressed in either carcinoma or normal mucosa in over 20% of the population were associated with one or more of the nine pathways. As is shown in **[Figure 3](#Figure3){ref-type="fig"}** (**[Supplementary Table S2](#TableS2){ref-type="table"}** shows mRNAs and miRNAs within pathways in more detail), the majority of associations were indirect, implying that many effects of the miRNAs come from their involvement in feedback loops, rather than directly binding to an mRNA. We determined that 40 miRNAs had a direct effect on gene expression because of a high likelihood of binding to the mRNA. Those miRNAs involved in regulating gene expression in various pathways are: miR-106b-5p (JAK-STAT-signaling), miR-1243 (Wnt-signaling), miR-1271-5p (NFκB-signaling), miR-145-5p (cell cycle control, apoptosis, and PI3K-AKT-signaling), miR-150-5p (cell cycle control, p53-signaling, apoptosis), miR-17-5p (JAK-STAT-signaling, NFκB-signaling, MAPK-signaling, PI3K-AKT-signaling), miR-193b-3p (MAPK-signaling), miR-195-5p (JAK-STAT-signaling, cell cycle control, apoptosis), miR-196b-5p (p53-signaling, apoptosis, NFκB-signaling, PI3K-AKT-signaling), miR-199a-5p (NFκB-signaling), miR-19b-3p (JAK-STAT-signaling, MAPK-signaling, PI3K-AKT-signaling), miR-203a (JAK-STAT-signaling, apoptosis, NFκB-signaling, MAPK-signaling, PI3K-AKT-signaling, Wnt-signaling), miR-204-3p (Wnt-signaling), miR-20a-5p (JAK-STAT-signaling, MAPK-signaling, PI3K-AKT-signaling), miR-20b-5p (JAK-STAT-signaling, apoptosis, NFκB-signaling, MAPK-signaling, PI3K-AKT-signaling), miR-2117 (MAPK-signaling), miR-214-3p (NFκB-signaling, PI3K-AKT-signaling), miR-215 (NFκB-signaling), miR-21-5p (JAK-STAT-signaling, PI3K-AKT-signaling), miR-221-3p (JAK-STAT-signaling, MAPK-signaling, PI3K-AKT-signaling), miR-23a-3p (JAK-STAT-signaling, PI3K-AKT-signaling), miR-27a-3p (JAK-STAT-signaling, PI3K-AKT-signaling), miR-29b-3p (apoptosis, MAPK-signaling, PI3K-AKT-signaling), miR-324-5p (NFκB-signaling), miR-3591-3p (Wnt-signaling), miR-365a-3p (NFκB-signaling), miR-375 (cell cycle control, TGFβ-signaling, NFκB-signaling, PI3K-AKT-signaling), miR-424-3p (cell cycle control), miR-429 (JAK-STAT-signaling, NFκB-signaling, MAPK-signaling), miR-4749-3p (TGFβ-signaling), miR-501-3p (apoptosis, MAPK-signaling, PI3K-AKT-signaling), miR-590-5p (NFκB-signaling), miR-6071 (MAPK-signaling, PI3K-AKT-signaling), miR-650 (JAK-STAT-signaling, cell cycle control, p53-signaling, apoptosis, PI3K-AKT-signaling), miR-6515-5p (cell cycle control, PI3K-AKT-signaling), miR-663b (NFκB-signaling, PI3K-AKT-signaling), miR-92a-3p (JAK-STAT-signaling, apoptosis), miR-934 (NFκB-signaling), miR-93-5p (JAK-STAT-signaling). These miRNAs also were involved indirectly in several pathways (**[Supplementary Table S2](#TableS2){ref-type="table"}**). {#Figure3} Many of the miRNAs have previously been reported associated with genes or biological responses that could impact CRC. For instance, miR-590-5p, miR-106b, and miR-93 have been associated with *PTEN* in the PI3K/AKT pathway^[@b34],[@b35]^; miR-145 has been associated with cell-cycle related factors such as *CDK4* and cyclin E2^[@b36]^; miR-150 has been associated with immune response^[@b37]^ and reducing inflammatory cytokine production^[@b38]^; miR-17-5p has been shown to inhibit proliferation and trigger apoptosis^[@b39]^; miR-199 has previously been associated with *IKKB*^[@b40]^ and with *ITGA3*^[@b41]^; miR-203 as being associated with *BIRC5* which encodes survivin^[@b42]^; miR-20 has previously been associated with cyclin D1^[@b43]^; miR-221 has been reported as being associated with TNFα^[@b40]^; miR-650 has been associated with *BCL2* and *AKT2* and has been shown to promote cell proliferation and invasion^[@b44]-[@b46]^. However, our findings add to the functional information we have for these miRNAs in that we observed their associations with genes not previously reported and with specific disease pathways. Additionally, our findings show associations for other miRNAs that are directly related to signaling pathways and to genes that are dysregulated in CRC. To further understand how miRNAs work in complex networks, we have assessed the interactions between TFs and miRNAs, both of which play important roles in regulating gene expression. We found that both miRNAs and TFs influence mRNA expression, and effect of one regulator influences the impact the other has on mRNA expression^[@b47],[@b48]^. In normal colonic mucosa we identified significant feed back loop (FBL) interactions involving miR-1258, miR-145-5p, miR-150-5p, 193b-3p, miR-330-3p, and miR-4469. In differential expression we identified FBL interactions involving miR-23a-3p and miR-4469. MiR-330-3p and miR-4469 were associated with one mRNA each in a few pathways, and no significant findings were identified with miR-1258. MiR-150-5p had numerous indirect associations in seven of the pathways (apoptosis, cell cycle, JAK-STAT-signaling, MAPK-signaling, NFκB-signaling, PI3K-AKT-signaling, and Wnt-signaling), and had direct associations in apoptosis, cell cycle, and p53-signaling. MiR-145-5p had numerous indirect associations in all pathways except apoptosis, and was involved in direct associations in apoptosis, cell cycle, and PI3K-AKT-signaling. MiR-23a-3p had a direct association with *IL6R* in JAK-STAT-signaling and PI3K-AKT-signaling, and indirect associations with seven mRNAs in the cell cycle, MAPK-signaling, PI3K-AKT-signaling, TGFβ-signaling, p53-signaling, and Wnt-signaling pathways. While some mRNAs were consistent across these studies, such as *MYC*, which has roles in numerous pathways and is a TF, many of the mRNAs associated with these miRNAs varied between our pathway analysis and FBL analysis, highlighting the variance that occurs in these types of investigations. The miRNAs and target genes we identified were limited to the nine pathways we determined as being important in CRC, given the number of TSGs, OGs, and TFs in these pathways that were associated with miRNAs. We undoubtedly missed associations utilizing only our gene expression data, however given the nature of the study, it was impossible to obtain information on proteins. It is probable that important associations were not identified given the post-transcriptional role of miRNAs. However, it is also likely that the associations identified are real, and therefore merit validation in other similarily designed studies is needed. Ongoing challenges and conclusions {#s05} ================================== While advancements are being made in understanding how miRNAs function in the carcinogenic process, there are many challenges when transitioning miRNAs from the discovery stage to their entering the realm of possible therapeutic agents. One of the biggest challenges stems from the fact that miRNAs target multiple genes and genes are targeted by multiple miRNAs. It is unclear if altering a single miRNA is sufficient to achieve a desired response, or if multiple miRNAs have to be considered as a complex that work within a given system to attain the outcome. Likewise, when investigating a specific miRNA that is associated with multiple genes, it is unclear whether regulation of a particular mRNA produces a certain outcome, or if this effect is the result of the regulation of a subgroup of the associated mRNAs or all of the mRNAs. Most functional studies have looked at single miRNAs when determining their functionality. Also of consideration is the fact that using a target miRNA may have unwanted effects, given that an miRNA can target many genes. It is unclear if a simple approach within the complex human system is sufficient to meaningfully pinpoint miRNAs for theraupeutic purposes. While we know that miRNAs are a part of a complex network, pinpointing their functionality within that framework remains a challenge. Acknowledgements {#s06} ================ This study was supported in part by National Cancer Institute (NCI, Grant No.CA163683). Partial support for this manuscript came form the Huntsman Cancer Institute. The contents of this manuscript are solely the responsibility of the authors and do not necessarily represent the official view of the NCI. Conflict of interest statement {#s07} ============================== No potential conflicts of interest are disclosed. Supplementary material {#sm00} ====================== ###### Associations between miRNAs identified in random forest assessment that are associated with genes with a seed region match and negative beta coefficient in CRC related pathways MiRNA Apoptosis Cell cycle JAK/STAT MAPK NFKB PI3K/AKT TP53 TGFB WNT ------------- ------------- ------------------- ------------------ ---------------------------- ------------------------ ---------------------------------- ---------------- ---------- --------- MiR-106b-5p *IL10RA* MiR-1243 *ROCK2* MiR-1271-5p *TRAF5* MiR-145-5p *BIRC5* *MAD2L1*, *SMC1A* *BRCA1* MiR-150-5p *BIRC5* *CCNA2*, *PRKDC* *PRKCB* *RPM2* MiR-17-5p *IL10RA*, *IL6R* *PDGFRA* *TNFRSF11A* *PDGFRA* MiR-193b-3p *DUSP4* MiR-195-5p *BIRC5* *CDC6*, *SMC1A* MiR-196b-5p *CREB3L1* MiR-196b-5p *TNFRSF10B* *TNFRSF11A* *TNFRSF10B* MiR-199a-5p *TNFRSF11A* MiR-19b-3p *IL6R* *PDGFRA* *PDGFRA* MiR-203a *BLC2* *LIFR* *MEF2C*, *PDGFRA*, *PRKCB* *BTK*, *BCL2*, *PLCG2* *PIK3CG*; *ITGA4*; *PDGFRA* MiR-204-3p *BCL2* *ROCK2* MiR-20a-5p *1L10RA*, *IL6R* *PDGFRA*; *IL6R* MiR-20b-5p *CTSS* *IL10RA*, *IL6R* *BTK* *PDGFRA*; *IL6R*, *BCL2*, *GNG2* MiR-2117 *TGFBR1* *TGFBR1* MiR-214-3p *TNFRSF11A* *PHLPP2* MiR-215 *PLAU* MiR-21-5p *IL6R* MiR-221-3p *IL6R* MiR-23a-3p *IL6R* MiR-27a-3p *IL6R* MiR-29b-3p *CASP7* *PDGFRA* MiR-324 *CCL13* MiR-3591-3p *SFRP5* MiR-3651 *IL6R* MiR-365a-3p *TNFRSF11A* MiR-375 *YWHAB* *PLCG1* *YWHAB*, *THBS2* *TGIF2* MiR-424-3p *CDC6* MiR-429 *IL10RA* *RASGRP3* *PLCG2* MiR-4749-3p *TGIF2* MiR-501-3p *CTSS* *PDGFRA* MiR-6071 *TGFBR1* *ITGAV* *TGFBR1* MiR-650 *BIRC5* *MAD2L1* *PTPN11* *PERP*; *RPM2* MiR-6515-5p *YWHAB* *YWHAB* MiR-663b *PHLPP2* MiR-92a-3p *CSF2RB* *CSF2RB* *TNFSF11A* MiR-934 *TNFRSF11A* MiR-93-5p *IL10RA* ###### MiRNA and mRNA associations by pathway MiRNA Direction Apoptosis Cell cycle JAK-STAT MAPK NFkB PI3K-AKT TGFB p53 WNT ----------------- ------------ ----------------------------------------------- ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ----------------------------------------------------------------------------------------- -------------------------------------------------------------------- --------------------------------------------------------------------- ------------------------------------------------------------------------------------------------------------------- ----------------------------------------- --------------------------------------------------- ------------------------------------ hsa-let-7i-5p Indirect *YWHAB* *TGFBR1* *COL1A2*, *COL6A3*, *F2R*, *ITGAV*, *THBS2*, *TNC*, *YWHAB* *INHBA*, *TGFBR1* *CCND1*, *CDK1* *SFRP4*, *SFRP5* hsa-miR-106b-5p Direct *IL10RA* hsa-miR-106b-5p Indirect *BIRC5* *BUB3*, *CCNA2*, *CCND1*, *CDC25C*, *CDK1*, *MAD2L1*, *MCM3*, *MCM4*, *MCM6*, *PRKDC*, *RAD21*, *YWHAB*, *YWHAG*, *YWHAQ* *CCND1*, *PTPN11* *CCND1*, *ITGA2*, *YWHAB*, *YWHAG*, *YWHAQ* *TGIF2* *RRM2* *CCND1* hsa-miR-10a-5p Indirect *ITGA2* hsa-miR-1203 Indirect *CSF2RB* *CSF2RB* *TGFBR1* *ITGAV* *TGFBR1* hsa-miR-124-3p Indirect *CSF2RB* *CSF2RB* *DAAM2* hsa-miR-1243 Direct *ROCK2* hsa-miR-1243 Indirect *ITGAV* hsa-miR-1246 Indirect *BIRC5* *ESPL1*, *MCM6*, *MYC*, *PRKDC*, *RAD21*, *RBL1*, *YWHAB* *MYC*, *PTPN11* *MYC* *PLCG1* *BRCA1*, *MYC*, *YWHAB* *MYC*, *RBL1*, *TGIF2* *MYC* hsa-miR-1271-5p Direct *TRAF5* hsa-miR-1291 Direct hsa-miR-1291 Indirect *ITGA2* *TGIF2* *PERP* hsa-miR-130b-3p Indirect *CCNA2*, *ESPL1*, *MAD2L1*, *MCM4*, *PRKDC*, *YWHAB* *PLCG1* *YWHAB* *TGIF2* hsa-miR-133b Indirect *FHL1*, *LIFR* *CXCL12* *CHRM2*, *TNXB* *DAAM2*, *PRICKLE2* hsa-miR-145-5p Direct *BIRC5* *MAD2L1*, *SMC1A* *BRCA1* hsa-miR-145-5p Indirect *BUB1B*, *CCNB1*, *CDC20*, *CDC25C*, *CDC6*, *MCM4*, *TFDP1* *FHL1*, *LIFR* *PDGFRA* *CXCL12* *CHRM2*, *IGF1*, *PDGFRA*, *THBS1*, *TNXB* *TFDP1*, *THBS1* *CCNB1*, *GTSE1*, *IGF1*, *RRM2*, *THBS1* *DAAM2*, *PRICKLE2*, *SFRP4* hsa-miR-146a-5p Indirect *TRAF5* hsa-miR-146b-5p Indirect *STAT1* *F2R*, *TNC* hsa-miR-150-5p Direct *BIRC5* *CCNA2*, *PRKDC* RRM2 hsa-miR-150-5p Indirect *BCL2*, *CSF2RB*, *ITPR1*, *PIK3CD*, *TUBA1B* *SMC1A* *BCL2*, *CSF2RB*, *IL10RA*, *IL24*, *IL6R*, *IL6ST*, *IL7R*, *LIFR*, *PIK3CD*, *PTPN11* *MAP4K1*, *MEF2C*, *PDGFRA*, *PRKCB*, *RAC2*, *RASGRP2*, *RASGRP3* *BCL2*, *BTK*, *CCL21*, *CD40*, *CXCL12*, *PLCG2*, *PRKCB*, *ZAP70* *BCL2*, *CD19*, *GNG2*, *GNG7*, *IL6R*, *IL7R*, *ITGA4*, *PDGFRA*, *PHLPP2*, *PIK3CD*, *PIK3CG* *DAAM2*, *PLCB2*, *PRKCB*, *RAC2* hsa-miR-151a-3p Indirect *CDC16*, *PRKDC*, *RAD21*, *YWHAB* *YWHAB* *TGIF2* *PERP* hsa-miR-15a-5p Indirect *CDC16*, *RAD21*, *YWHAB* *YWHAB* hsa-miR-17-5p Direct *IL10RA*, *IL6R* *PDGFRA* *TNFRSF11A* *PDGFRA*, *IL6R* hsa-miR-17-5p Indirect *BIRC5* *ANAPC1*, *CCNA2*, *CCND1*, *CDC16*, *CDC25C*, *CDK1*, *CDK4*, *E2F5*, *ESPL1*, *MAD2L1*, *MCM3*, *MCM4*, *MCM6*, *MYC*, *PRKDC*, *RAD21*, *RBL1*, *TFDP1*, *YWHAB*, *YWHAG*, *YWHAQ* *CCND1*, *MYC*, *PTPN11* *HSPA8*, *MYC* *PLCG1* *BRCA1*, *CCND1*, *CDK4*, *GNG4*, *ITGA2*, *LAMA5*, *MYC*, *YWHAB*, *YWHAG*, *YWHAQ* *E2F5*, *MYC*, *RBL1*, *TFDP1*, *TGIF2* *CCND1*, *CDK1*, *CDK4*, *PERP*, *RRM2* *CCND1*, *MYC*, *ROCK2* hsa-miR-1915-5p Indirect *SFRP5* hsa-miR-193b-3p Direct *DUSP4* hsa-miR-193b-3p Indirect *CTSK* *YWHAB* *FHL1*, *LIFR* *IL1R1*, *MEF2C*, *PDGFRB* *CXCL12*, *IL1R1*, *TNFRSF11A* *COL1A1*, *COL1A2*, *COL6A3*, *CREB3L1*, *F2R*, *ITGA11*, *ITGB5*, *LAMA5*, *PDGFRB*, *THBS2*, *YWHAB* *TGIF2* *PRICKLE2*, *SFRP4*, *SFRP5* hsa-miR-195-5p Direct *BIRC5* *CDC6*, *SMC1A* *PTPN11* hsa-miR-195-5p Indirect *BCL2*, *TUBA1B* *CCNB1*, *MAD2L1* *BCL2*, *FHL1*, *IL10RA*, *IL6ST*, *LIFR* *MEF2C* *BCL2*, *CCL21*, *CXCL12*, *PLCG2* *BCL2* *CCNB1*, *RRM2* *DAAM2* hsa-miR-196a-5p Indirect *ANAPC1*, *CCNA2*, *CDC25A*, *CDC6*, *MAD2L1*, *PRKDC*, *RAD21*, *YWHAB* *YWHAB* *TGIF2* *GTSE1*, *STEAP3* hsa-miR-196b-5p Direct *TNFRSF10B* *TNFRSF11A* *CREB3L1* *TNFRSF10B* hsa-miR-196b-5p Indirect *RBL1*, *YWHAB* *DUSP4* *PLCG1* *PHLPP2*, *SGK2*, *YWHAB* *RBL1*, *TGIF2* *PLCB4* hsa-miR-199a-3p Indirect *TUBA1B* *YWHAB* *PDGFRB*, *TGFBR1* *COL1A1*, *COL1A2*, *COL6A3*, *F2R*, *ITGA11*, *ITGAV*, *ITGB5*, *PDGFRB*, *THBS2*, *TNC*, *YWHAB* *INHBA*, *TGFBR1* *SFRP4* hsa-miR-199a-5p Direct *TNFRSF11A* hsa-miR-199a-5p Indirect *TUBA1B* *YWHAB* *PDGFRB*, *TGFBR1* *COL1A1*, *COL1A2*, *COL6A3*, *F2R*, *ITGA11*, *ITGAV*, *ITGB5*, *PDGFRB*, *THBS2*, *TNC*, *YWHAB* *INHBA*, *TGFBR1* *SFRP4* hsa-miR-199b-5p Indirect *TUBA1B* *CDC16*, *YWHAB* *PDGFRB* *COL1A1*, *COL1A2*, *COL6A3*, *F2R*, *ITGA11*, *ITGB5*, *PDGFC*, *PDGFRB*, *THBS2*, *TNC*, *YWHAB* *INHBA* *PERP* *SFRP4* hsa-miR-19b-3p Direct *IL6R* *PDGFRA* *IL6R*, *PDGFRA* hsa-miR-19b-3p Indirect *BIRC5* *ANAPC1*, *BUB3*, *CCND1*, *CDC16*, *CDC25C*, *CDK1*, *ESPL1*, *MAD2L1*, *MCM3*, *MCM4*, *MCM6*, *MYC*, *PRKDC*, *RAD21*, *RBL1*, *TFDP1*, *YWHAB*, *YWHAG*, *YWHAQ* *CCND1*, *MYC*, *PTPN11* *MYC* *BRCA1*, *CCND1*, *ITGA2*, *MYC*, *YWHAB*, *YWHAG*, *YWHAQ* *MYC*, *RBL1*, *TFDP1*, *TGIF2* *CCND1*, *CDK1*, *PERP*, *RRM2* *CCND1*, *MYC*, *ROCK2* hsa-miR-203a Direct *BCL2* *BCL2*, *LIFR* *MEF2C*, *PDGFRA*, *PRKCB* *BCL2*, *BTK*, *PRKCB*, *PLCG2* *BCL2*, *GNG2*, *ITGA4*, *PDGFRA*, *PIK3CG* *PRKCB* hsa-miR-203a Indirect *CCND1*, *CDC25C*, *PRKDC*, *RAD21* *CCND1*, *IL10RA*, *IL6R*, *IL7R*, *PTPN11* *HSPA8*, *RAC2* *CCL21* *CCND1*, *HSP90AA1*, *HSP90AB1*, *IL6R*, *IL7R*, *ITGA2* *CCND1*, *PERP* *CCND1*, *RAC2* hsa-miR-204-3p Direct *ROCK2* hsa-miR-204-3p Indirect *ITGAV* hsa-miR-20a-5p Direct *IL6R*, *IL10RA* *PDGFRA* *IL6R*, *PDGFRA* hsa-miR-20a-5p Indirect *BIRC5* *ANAPC1*, *CCND1*, *CDC16*, *CDK4*, *E2F5*, *ESPL1*, *MAD2L1*, *MCM3*, *MCM4*, *MCM6*, *MYC*, *PRKDC*, *RAD21*, *RBL1*, *TFDP1*, *YWHAB*, *YWHAG*, *YWHAQ* *CCND1*, *MYC*, *PTPN11* *MYC* *PLCG1* *BRCA1*, *CCND1*, *CDK4*, *GNG4*, *HSP90AB1*, *ITGA2*, *MYC*, *YWHAB*, *YWHAG*, *YWHAQ* *E2F5*, *MYC*, *RBL1*, *TFDP1*, *TGIF2* *CCND1*, *CDK4*, *PERP*, *RRM2* *CCND1*, *MYC*, *ROCK2* hsa-miR-20b-5p Direct *CTSS* *IL6R*, *IL10RA* *PDGFRA* *BTK*, *TNFRSF11A* *IL6R*, *PDGFRA* hsa-miR-20b-5p Indirect *BIRC5* *ANAPC1*, *BUB3*, *CCNA2*, *CCND1*, *CDC16*, *CDC25C*, *CDK1*, *CDK4*, *MAD2L1*, *MCM3*, *MCM4*, *MCM6*, *MYC*, *PRKDC*, *RAD21*, *RBL1*, *TFDP1*, *YWHAB*, *YWHAG*, *YWHAQ* *CCND1*, *MYC*, *PTPN11* *MYC* *CSNK2A2*, *PLCG1* *BRCA1*, *CCND1*, *CDK4*, *GNG4*, *ITGA2*, *MYC*, *YWHAB*, *YWHAG*, *YWHAQ* *MYC*, *RBL1*, *TFDP1*, *TGIF2* *CCND1*, *CDK1*, *CDK4*, *PERP*, *RRM2*, *STEAP3* *CCND1*, *CSNK2A2*, *MYC*, *ROCK2* hsa-miR-21-3p Indirect *BIRC5* *PRKDC*, *RAD21*, *TFDP1*, *YWHAB*, *YWHAG*, *YWHAQ* *PTPN11* *ITGAV*, *YWHAB*, *YWHAG*, *YWHAQ* *TFDP1* *PERP*, *RRM2* *CTNNB1* hsa-miR-21-5p Direct *IL6R* *IL6R* hsa-miR-21-5p Indirect *CCND1*, *PRKDC*, *RAD21*, *YWHAB*, *YWHAG* *CCND1*, *PTPN11* *TGFBR1* *CCND1*, *ITGA2*, *ITGAV*, *LPAR1*, *TNC*, *YWHAB*, *YWHAG* *INHBA*, *TGFBR1* *CCND1*, *PERP* *CCND1*, *ROCK2*, *SFRP5* hsa-miR-2117 Direct *TGFBR1* hsa-miR-2117 Indirect *CSF2RB* *CSF2RB*, *IL6R* *IL6R* *TGFBR1* hsa-miR-214-3p Direct *TNFRSF11A* *PHLPP1* hsa-miR-214-3p Indirect *TUBA1B* *IL1R1*, *PDGFRB*, *TGFBR1* *IL1R1* *COL1A1*, *COL1A2*, *COL6A3*, *F2R*, *ITGA11*, *ITGAV*, *ITGB5*, *PDGFRB*, *THBS2*, *TNC* *INHBA*, *TGFBR1* *SFRP4* hsa-miR-215 Direct *PLAU* hsa-miR-215 Indirect *COL1A1* hsa-miR-221-3p Direct *IL6R* *MEF2C* *IL6R* hsa-miR-221-3p Indirect *CASP7* *CCND1*, *CDK1*, *MCM3*, *MCM4*, *MCM6*, *PRKDC*, *RAD21*, *YWHAB*, *YWHAG*, *YWHAQ* *CCND1*, *IL10RA*, *PTPN11* *HSPA8* *CCL13* *CCND1*, *HSP90AB1*, *ITGA2*, *YWHAB*, *YWHAG*, *YWHAQ* *TGIF2* *CCND1*, *CDK1*, *RRM2*, *PERP* *CCND1*, *CTNNB1* hsa-miR-222-3p Indirect *PERP* *SFRP5* hsa-miR-23a-3p Direct *IL6R* *IL6R* hsa-miR-23a-3p Indirect *PRKDC*, *YWHAB* *TGFBR1* *ITGA2*, *ITGAV*, *YWHAB* *TGFBR1* *PERP* *SFRP5* hsa-miR-24-3p Indirect *PRKDC*, *YWHAB* *TGFBR1* *ITGA2*, *ITGAV*, *ITGB5*, *YWHAB* *TGFBR1* *PERP* *SFRP5* hsa-miR-25-3p Indirect *BIRC5* *BUB3*, *CCNA2*, *CCNB1*, *CDC25C*, *CDK1*, *ESPL1*, *MAD2L1*, *MCM3*, *MCM4*, *MCM6*, *PRKDC*, *RAD21*, *RBL1*, *SKP2*, *YWHAB*, *YWHAG*, *YWHAQ* *PTPN11* *PLCG1* *BRCA1*, *YWHAB*, *YWHAG*, *YWHAQ* *RBL1*, *TGIF2* *CCNB1*, *CDK1*, *RRM2* hsa-miR-27a-3p Direct *IL6R* *IL6R* hsa-miR-27a-3p Indirect *CCND1*, *PRKDC*, *RAD21*, *YWHAB*, *YWHAG*, *YWHAQ* *CCND1*, *PTPN11* *CCND1*, *ITGA2*, *ITGAV*, *YWHAB*, *YWHAG*, *YWHAQ* *CCND1*, *PERP* *CCND1*, *CTNNB1* hsa-miR-29a-3p Indirect *PRKDC*, *RAD21*, *YWHAB*, *YWHAQ* TRAF5 *ITGA2*, *YWHAB*, *YWHAQ* *PERP* *ROCK2*, *SFRP5* hsa-miR-29b-3p direct *CASP7* *PDGFRA* *PDGFRA* hsa-miR-29b-3p Indirect *CCND1*, *MCM3*, *MCM4*, *PRKDC*, *RAD21*, *YWHAB*, *YWHAG*, *YWHAQ* *CCND1*, *PTPN11* *HSPA8* *CCND1*, *ITGA2*, *YWHAB*, *YWHAG*, *YWHAQ* *CCND1*, *PERP* *CCND1* hsa-miR-30a-5p Indirect *FHL1*, *LIFR* *TNXB* *DAAM2* hsa-miR-3124-5p Indirect *CSF2RB*, *TNFRSF10B* *CSF2RB* *TNFRSF10B* hsa-miR-32-3p Indirect *YWHAB* *PTPN11* *YWHAB* hsa-miR-324-5p Direct *CCL13* hsa-miR-324-5p Indirect *PRKDC* *PERP* hsa-miR-330-3p Indirect *TNFRSF11A* hsa-miR-331-3p Indirect *TGFBR1* *LAMA5* *TGFBR1* hsa-miR-34a-5p Indirect *PRKDC*, *RAD21*, *YWHAB* *PTPN11* CCL13 *ITGA2*, *ITGAV*, *YWHAB* *PERP* hsa-miR-3591-3p Direct *SFRP5* hsa-miR-361-5p Indirect *CDC16*, *PRKDC*, *YWHAB* *TNFRSF11A* *YWHAB* *TGIF2* *SFRP5* hsa-miR-3651 Direct *IL6R* *IL6R* hsa-miR-3651 Indirect *CDK4*, *MYC*, *PRKDC*, *RAD21*, *RBL1*, *YWHAB*, *YWHAG*, *YWHAQ* *IL10RA*, *MYC*, *PTPN11* *MYC* *CDK4*, *GNG4*, *ITGA2*, *MYC*, *YWHAB*, *YWHAG*, *YWHAQ* *MYC*, *RBL1*, *TGIF2* *CDK4*, *PERP* *MYC*, *ROCK2*, *SFRP5* hsa-miR-365a-3p Direct *TNFRSF11A* hsa-miR-365a-3p Indirect *PRKDC* *ITGB5*, *TNXB* *GTSE1* hsa-miR-375 Direct *YWHAB* *PLCG1* *THBS2*, *YWHAB* *TGIF2* hsa-miR-375 Indirect *MYC* *MYC* *MYC* *TNFRSF11A* *COL1A1*, *CREB3L1*, *MYC* *MYC* *MYC* hsa-miR-378g Indirect *TRAF5* *SFRP5* hsa-miR-3923 Indirect *CTSS* *TRAF5* hsa-miR-3976 Indirect *TNXB* hsa-miR-424-3p Direct *CDC6* hsa-miR-424-3p Indirect *YWHAB*, *YWHAE* *OSM* *DUSP4* *PLCG1*, *TNFRSF11A* *CREB3L1*, *GNG4*, *OSM*, *YWHAB*, *YWHAE* *TGIF2* hsa-miR-425-5p Indirect *BIRC5* *PRKDC*, *RAD21*, *YWHAB*, *YWHAQ* *PTPN11* *BRCA1*, *COMP*, *YWHAB*, *YWHAQ* *TGIF2* hsa-miR-4251 Indirect *ITGAV* *SFRP5* hsa-miR-429 Direct *IL10RA* *RASGRP3* *PLCG2* hsa-miR-429 Indirect *PRKDC*, *RAD21* hsa-miR-4315 Indirect *CSF2RB* *CSF2RB* CTNNB1 hsa-miR-4421 *Indirect* SFRP5 hsa-miR-4469 Indirect *CSF2RB* *CSF2RB* hsa-miR-4638-3p Indirect *SFRP5* hsa-miR-4749-3p Direct *TGIF2* hsa-miR-4749-3p Indirect *YWHAB* *YWHAB* *ROCK2* hsa-miR-483-3p Indirect *TGIF2* hsa-miR-497-5p Indirect *IL6ST*, *LIFR* *CCL21*, *CXCL12* *LPAR1*, *TNXB* *DAAM2* hsa-miR-5008-3p Indirect *SFRP5* hsa-miR-501-3p Direct *CTSS* *PDGFRA* *PDGFRA* hsa-miR-501-3p Indirect *CDC25C*, *MAD2L1*, *MYC*, *PRKDC*, *YWHAB* *MYC* *MYC* *GNG4*, *ITGA2*, *MYC*, *YWHAB* *MYC*, *TGIF2* *PERP* *MYC* hsa-miR-518c-5p Indirect *CNTF*, *IL6R* *IL6R* hsa-miR-520d-3p Indirect *TRAF5* hsa-miR-525-5p Indirect *CSF2RB* *CSF2RB* hsa-miR-5685 Indirect *TRAF5* *SFRP5* hsa-miR-583 Indirect *MAD2L1*, *MYC*, *SMC1A* *MYC* *MYC* *PLCG1* *MYC* *MYC*, *TGIF2* *STEAP3* *MYC* hsa-miR-590-5p Direct *TNFRSF11A* hsa-miR-6071 Direct *TGFBR1* *ITGAV* hsa-miR-6071 Indirect *TGFBR1* hsa-miR-650 Direct *BIRC5* *MAD2L1* *PTPN11* *ITGA2* *PERP*, *RRM2* hsa-miR-650 Indirect *BCL2*, *CSF2RB*, *ITPR1*, *PIK3CD* *CCNA2*, *MCM4*, *PRKDC*, *RAD21*, *YWHAG*, *YWHAH* *BCL2*, *CSF2RB*, *IL10RA*, *IL6R*, *IL6ST*, *IL7R*, *LIFR*, *PIK3CD* *MAP4K1*, *MEF2C*, *PDGFRA*, *PRKCB*, *RAC2*, *RASGRP2*, *RASGRP3* *BCL2*, *BTK*, *CCL21*, *CD40*, *PLCG2*, *PRKCB* *BCL2*, *BRCA1*, *GNG2*, *GNG7*, *IL6R*, *IL7R*, *ITGA4*, *PDGFRA*, *PIK3CD*, *PIK3CG*, *YWHAG*, *YWHAH* *PLCB2*, *PRKCB*, *RAC2* hsa-miR-6515-5p Direct *YWHAB* *YWHAB* hsa-miR-6515-5p Indirect *CSNK2A2* *CREB3L1*, *HSP90AB1* *CSNK2A2*, *ROCK2* hsa-miR-663a Indirect *MYC*, *YWHAB* *MYC* *MYC* *GNG4*, *MYC*, *YWHAB* *MYC* *MYC*, *ROCK2* hsa-miR-663b Direct *TNFRSF11A* *PHLPP1* hsa-miR-663b Indirect *MYC*, *PRKDC*, *RBL1*, *YWHAB* *MYC* *MYC* *PLCG1* *GNG4*, *HSP90AB1*, *ITGA2*, *MYC*, *YWHAB* *MYC*, *RBL1*, *TGIF2* *PERP* *MYC*, *PLCB4*, *ROCK2* hsa-miR-6716-3p Indirect *SFRP5* hsa-miR-92a-3p Direct *CSF2RB* *CSF2RB* hsa-miR-92a-3p Indirect *BCL2L1* *ANAPC1*, *CDC16*, *MYC*, *PRKDC*, *RAD21*, *RBL1*, *TFDP1*, *YWHAB*, *YWHAQ* *BCL2L1*, *IL6R*, *MYC*, *PTPN11* *MYC* *BCL2L1*, *CSNK2A2*, *PLCG1*, *TNFRSF11A*, *TRAF5* *BCL2L1*, *BRCA1*, *CREB3L1*, *GNG4*, *IL6R*, *ITGA2*, *MYC*, *YWHAB*, *YWHAQ* *MYC*, *TFDP1*, *TGIF2*, *RBL1* *PERP* *CSNK2A2*, *MYC*, *PLCB4*, *ROCK2* hsa-miR-93-5p Direct *IL10RA* hsa-miR-93-5p Indirect *BIRC5* *ANAPC1*, *BUB1*, *BUB3*, *CCNA2*, *CCNB1*, *CCND1*, *CDC25C*, *CDC6*, *CDK1*, *CDK4*, *ESPL1*, *MAD2L1*, *MCM3*, *MCM4*, *MCM6*, *PRKDC*, *RAD21*, *RBL1*, *SKP2*, *YWHAB*, *YWHAG*, *YWHAQ* *CCND1*, *PTPN11* *HSPA8* *BRCA1*, *CCND1*, *CDK4*, *ITGA2*, *YWHAB*, *YWHAG*, *YWHAQ* *TGIF2*, *RBL1* *CCNB1*, *CCND1*, *CDK1*, *CDK4*, *RRM2* *CCND1*, *ROCK2* hsa-miR-934 Direct *TNFRSF11A* hsa-miR-934 Indirect *TUBA1B* *OSM* *PDGFRB* *PLAU* *COL1A1*, *COL1A2*, *COL6A3*, *COMP*, *F2R*, *ITGA11*, *ITGAV*, *ITGB5*, *OSM*, *PDGFC*, *PDGFRB*, *THBS2*, *TNC* *INHBA* *SFRP4* hsa-miR-99a-5p Indirect *LIFR* *ITGA11*, *ITGB5*, *PDGFC*, *TNXB* *GTSE1*, *RRM2* *SFRP4*

var gqlwx = require('../graphql/wxgql'); var GraphQL = gqlwx.GraphQL; var gql = GraphQL( { //设置全局url url: 'https://users.authing.cn/graphql', // url必填 //设置全居动态header header: function () { return { // something.... 'X-Test-Header': 'test header content' } }, //设置全居错误拦截 errorHandler: function (res) { //do something } }, true ); module.exports = gql;

The Kremlin has described the conspiracy theory of the creation of the national guard as “personal detachment Putin” The Kremlin has described the conspiracy theory of the creation of the national guard as “personal detachment Putin” 06.04.2016 In the Kremlin deny that the creation of the National guard, whose commander-in-chief appointed a former security guard of the President Victor Zolotov, due to the mistrust of Vladimir Putin to other law enforcement agencies and the approaching electoral cycle. One of the functions of the new structure, indeed, is the protection of public order and providing emergency regime, but this does not mean that the authorities are preparing for mass protests. photo: Natalia Gubernatorova “This increase in efficiency and improvement work in the area of ensuring state and public security,” explained the need for the establishment of the national guard the President’s press Secretary Dmitry Peskov. He added that the work on reforming the interior Ministry was carried out in a long time. But the decision will require the adjustment of a large number of legislative acts and departmental documents. We will remind that on Tuesday at a meeting with the interior Minister Vladimir Kolokoltsev, head of the Federal drug control service Viktor Ivanov, the commander of Internal troops of the Ministry of internal Affairs Viktor Zolotov and Deputy head of the FMS Ekaterina Egorova, Vladimir Putin announced the most ambitious in the last 10 years, the reform of the interior Ministry internal troops, SWAT and riot police removed from the structure of the Agency to form the National guard. Instead, the interior Ministry will include the FMS (the number of staff will be reduced by 30%) and FDCS. Peskov in conversation with journalists has specified that the last two services concrete yet. We only know that the heads of anti-drug and migration Ministry of internal Affairs will become the Vice-Vladimir Kolokoltseva. But would it be the current head of the Federal drug control service Viktor Ivanov and the Federal migration service Konstantin Romodanovsky is not yet clear. (Later appeared a decree, from which it follows that the FMS will be transformed into the Directorate for migration and the Federal drug control service in the Directorate General for drug control, the reorganization should be completed by June 1, 2016) As for the National guard, in an hour after the meeting, the Kremlin has published the decree about its creation and the message that the commander-in-chief of the national guard who are assigned to Viktor Zolotov, included in the composition of the permanent members of the Security Council. The functions of the National guard in the decree assigned part (in conjunction with the Ministry of internal Affairs) in the protection of public order, security of state of emergency, the fight against terrorism and extremism, participation in territorial defence of Russia, the protection of important goudeseune objects etc. Along with the internal troops of the Ministry of internal Affairs, SOBR and the OMON in the new structure includes units of the interior Ministry, which oversees the circulation in the arms and in the field of private security, the Center for special purpose rapid reaction force and aviation Ministry of internal Affairs and the Federal state unitary enterprise “Protection”. Zolotov, the full title of which is “Director of Federal service the national guard troops of the Russian Federation – chief of the troops of the national guard of the Russian Federation” are allowed to have six deputies. In this case, he will receive salary at the level of the Federal Minister, his first Deputy – the first Deputy Minister, ordinary deputies – Deputy Ministers. Dmitry Peskov insists that the creation of the national guard “will not require an increase in staff numbers and will not lead to the increase of the device”. – It is wrong to say that the number of law enforcement agencies increases – not increases it. The Federal drug control service will become part of the MIA, and it turns out the minus one power Department. And plus one – the national guard – said the press Secretary of the head of state. According to him, the announced reform will lead to the optimization of the structure of power block and cost of its maintenance. “The structure is not static, it changes in accordance with the requirements of the time. A result of an internal study came to the conclusion that at this stage more appropriate this structure,” added Sands. Journalists suggested that the creation of the National guard to do with the upcoming electoral cycle, which in the case of the deterioration of the economic situation may result in mass protests, and that the new structure will become a “private armed group” to the President. But Dmitry Peskov said that both the rumor is not baseless. However, he acknowledged that Vladimir Putin is experiencing personal trust to Viktor Zolotov. “The President does not appoint people to lead the security forces, not caring for them personal trust. Zolotov has extensive experience in the security services, it is a good Foundation to guide such a large service like the national guard,” – said the representative of the Kremlin. Special personal confidence shines through even in the character’s position. Earlier in Russia there was only one commander-in-chief, and now two of them. However, Peskov stressed that Zolotov is subordinate to Vladimir Putin. Read the article “Putin has created a National guard and expanded the functions of the Ministry of internal Affairs for the sake of Zolotova”

The natural history of conduct disorder symptoms in female inmates: on the predictive utility of the syndrome in severely antisocial women. This study examined the utility of the conduct disorder (CD) diagnosis in predicting antisocial personality disorder (ASPD) among incarcerated women. It was surprising that most female inmates did not meet standard criteria for ASPD. This was due to a low occurrence of CD symptoms reported before age 15. Cluster analysis of CD symptoms revealed 4 types that characterized women with criminal histories. One type, which was characterized by a history of CD with interpersonal and physical aggression, was more predictive of ASPD than the traditional CD diagnosis. Yet another type, characterized by destruction of property, also represented an improvement over the traditional CD diagnosis. Overall, the results suggest that the types of CD behaviors, rather than their number, may be a more important indicator for identifying women at risk for future antisocial personality pathology.

What's Up, Up Here? Mammoth News and gossip for June 8-14 Now that Tim Alpers is off the stump, he can seriously get to work on 1. Helping run the county and 2. Finishing that book about the history of the Alpers Ranch. It’s to be a vivid look into the history of the Eastern Sierra, too. Oh, and that basketball book? The former assistant coach at Tulsa (Alpers) is working on how in the Golden Hurricane World, coaches tried (and failed) to create a defense against Indiana State’s Larry Bird, Drake’s Lewis Lloyd and how to create an offense against Drake University’s Final Four Bulldogs team, featuring Coach Maury John’s “Belly-Button Defense.” … Interesting list of the faculty at Mammoth High School in this year’s yearbook, except for maybe that Whoops! That would be leaving out the estimable Chris Cooper, he of fine feathers and impresario of fine words. … Who is Elizabeth Katherine Bauer? According to news reports out of Laguna Beach, she’s an attorney in Mammoth (news to local attorneys here), was a go-getter on its Pet Responsibility Committee, has a law degree from Boston University, and has no record whatsoever of her inability to practice law. Except maybe for that alleged $72,000 embezzlement of funds from the P.U.P. Laguna (Protecting Unwanted Pets), and who is now facing embezzlement charges along with grand theft. Wha?!? Officials reportedly say she used the dough to pay rent on a Dana Point home, purchase lift tix in Mammoth and to make repairs on her Mammoth property at 515 Forest Trail. … It’s a Go this summer for the Rock ‘n’ Bowl bowling/golf/restaurant facility, says developer Dan O'Connell. Drawings and documents are late. He says he’s still committed to the project, but later than expected. … On the other hand, the new Roller Rink (in the winter, it’s the Ice Rink) opens today (Friday) at 3 p.m. On Wednesday, Recreation staffer John Connolly was supervising installation of the mini-ramp. … Intrepid mountaineer and adventurer Andy Selters has just launched his “Hidden Himalaya” project. At the end of July he’s heading to a remote valley of Ladakh where no one but locals have ever been, with three Canadians. They hope to climb a 21,000-foot peak or two. No photographs of the peaks exist. Then Andy will hang with villagers and document life there. … Monday was the first day of official work at the motocross track, what with fencing and unpacking boxes. Entries are getting strong with a few more spots available in some classes. That little rain really helped with the preparation. … Dan Hicks, he of the Hot Licks, was a big hit last weekend with his Kollege of Musical Knowledge at Lone Pine’s “Concert in the Rock” series in the Alabama Hills. Yup, that was The Famous One, traipsing around the Alabama Hills with Buck Wahl, among others. … Wednesday was National Runners Day, in case you missed it. Our guys didn’t. Here’s Meb Keflezighi on how it all started: “I run to get the best out of myself. I started running to get an “A” in PE, now I am running to win the biggest races in the world.” And Josh Cox? “I run because everything is funner with a runner.” Oh yeah and by the way: Olympian Keflezighi won the Rock ‘n’ Roll San Diego Half Marathon in 1 hour, 3 minutes, 11 seconds on Sunday for his second consecutive victory in his adopted hometown. He beat fellow U.S. Olympian Ryan Hall, who struggled because of plantar fasciitis in his left foot and finished in 1:05:39. Meb-the-K and Ryan also finished 1-2 in the U.S. Olympic marathon trial. Success! Paraplegic athlete Jeremy McGhee and his “Drop-In” team made it all the way up Bloody Couloir, he in a wheelchair, then made it down safely and smiling. He was taken to Mammoth Hospital for a routine checkup after feeling dehydrated, exhausted, and cold. Everything is A-OK now. The television version, Episode #1: Bloody Couloir, is officially in the can. … Yosemite National Park has a “fee free” day tomorrow, June 9. It’s in celebration of National Get Outdoors Day. In case you forgot, or never knew, National Get Outdoors Day began in 2008 to encourage the American people to dedicate a single day to being outdoors and experiencing nature. Upcoming fee free dates in 2012 include National Public Lands Day (Sept. 29) and Veterans Day Weekend (Nov. 10 – 12).

Association of small CAB-like proteins (SCPs) of Synechocystis sp. PCC 6803 with Photosystem II. The cyanobacterial small CAB-like proteins (SCPs) are one-helix proteins with compelling similarity to the first and third transmembrane helix of proteins belonging to the CAB family of light-harvesting complex proteins in plants. The SCP proteins are transiently expressed at high light intensity and other stress conditions but their exact function remains largely unknown. Recently we showed association of ScpD with light-stressed, monomeric Photosystem II in Synechocystis sp. PCC 6803 (Yao et al. J Biol Chem 282:267-276, 2007). Here we show that ScpB associates with Photosystem II at normal growth conditions. Moreover, upon introduction of a construct into Synechocystis so that ScpB is expressed continuously under normal growth conditions, ScpE was detected under non-stressed conditions as well, and was copurified with tagged ScpB and Photosystem II. We also report on a one-helix protein, Slr1544, that is somewhat similar to the SCPs and whose gene is cotranscribed with that of ScpD; Slr1544 is another member of the extended light-harvesting-like (Lil) protein family, and we propose to name it LilA.

Nerve sprouting in muscle is induced and guided by processes extended by Schwann cells. Partial denervation or paralysis with botulinum toxin, manipulations that induce sprouting of nerve terminals in muscle, also induced terminal Schwann cells to extend processes. These processes were associated with every nerve sprout and in some cases were longer than the sprouts that appeared to be growing along them. Following partial denervation, more than 70% of the nerve sprouts that grew to innervate nearby denervated endplates were associated with Schwann cell processes that had extended from the denervated endplates, i.e., in the direction opposite to nerve growth. Implantation of Schwann cells into an innervated muscle induced sprouting upon contact of an axon or nerve terminal by Schwann cell processes. These observations show that Schwann cells induce and guide axonal sprouting in muscle.

/** * Copyright (c) Microsoft Corporation. All rights reserved. * Licensed under the MIT License. See License.txt in the project root for * license information. * * Code generated by Microsoft (R) AutoRest Code Generator. */ package com.microsoft.azure.management.network.v2019_08_01; import java.util.Collection; import com.fasterxml.jackson.annotation.JsonCreator; import com.microsoft.rest.ExpandableStringEnum; /** * Defines values for ProcessorArchitecture. */ public final class ProcessorArchitecture extends ExpandableStringEnum<ProcessorArchitecture> { /** Static value Amd64 for ProcessorArchitecture. */ public static final ProcessorArchitecture AMD64 = fromString("Amd64"); /** Static value X86 for ProcessorArchitecture. */ public static final ProcessorArchitecture X86 = fromString("X86"); /** * Creates or finds a ProcessorArchitecture from its string representation. * @param name a name to look for * @return the corresponding ProcessorArchitecture */ @JsonCreator public static ProcessorArchitecture fromString(String name) { return fromString(name, ProcessorArchitecture.class); } /** * @return known ProcessorArchitecture values */ public static Collection<ProcessorArchitecture> values() { return values(ProcessorArchitecture.class); } }

Q: Is System.out.println thread-safe by default? System.out returns the "standard" output stream - a PrintStream. The javadoc of PrintStream tells me nothing about thread safety but looking at the source of the OpenJDK and the OracleJDK tells me that println is synchronized. /** * Prints a String and then terminate the line. This method behaves as * though it invokes <code>{@link #print(String)}</code> and then * <code>{@link #println()}</code>. * * @param x The <code>String</code> to be printed. */ public void println(String x) { synchronized (this) { print(x); newLine(); } } That fits pretty well to my experiences: Calling System.out.println() never created 'mixed' output when calling from different threads. So my question(s): Can I rely on this behavior (using different JVMs)? Is there some documentation that I missed which describes this behavior? A: Since the documentation of PrintStream, its superclass FilterStream, and its superclass OutputStream all fail to say anything about thread safety or synchronization, in theory you cannot rely on it, it's not part of the contract. I think it would be surprising if someone produced a PrintStream class that didn't do what Oracle's does in this regard, but I've been surprised before.

Rod, I should have forwarded this to you a couple of weeks ago when I prepared this for Jim Prentice. Kerry

// Copyright 2017 The Go Authors. All rights reserved. // Use of this source code is governed by a BSD-style // license that can be found in the LICENSE file. // +build !gccgo #include "textflag.h" // // System call support for ARM, OpenBSD // // Just jump to package syscall's implementation for all these functions. // The runtime may know about them. TEXT ·Syscall(SB),NOSPLIT,$0-28 B syscall·Syscall(SB) TEXT ·Syscall6(SB),NOSPLIT,$0-40 B syscall·Syscall6(SB) TEXT ·Syscall9(SB),NOSPLIT,$0-52 B syscall·Syscall9(SB) TEXT ·RawSyscall(SB),NOSPLIT,$0-28 B syscall·RawSyscall(SB) TEXT ·RawSyscall6(SB),NOSPLIT,$0-40 B syscall·RawSyscall6(SB)

MIA – Ubuntu 19.04 Disco Dingo - sqreept The disco subfolder is no longer on Ubuntu&#x27;s server (http:&#x2F;&#x2F;archive.ubuntu.com&#x2F;ubuntu&#x2F;dists&#x2F;) causing apt to fail installing packages. ====== finchisko non LTS releases (19.04 is one) have only 9 months of support, so I guess this is expected. ~~~ sqreept Not having support is one thing. Breaking apt is what happened here.

The Art Institute of Dallas is a private college for creative professional studies based upon focused and balanced curricula. Our college prepares students for careers in design, media arts and culinary arts by providing an intensive educational environment and by responding to changing technology in order to meet the opportunities of a global economy. School Highlights South University-The Art Institute Of Dallas serves 1,155 students (81% of students are full-time). The college's student:teacher ratio of 21:1 is lower than the state community college average of 35:1. Minority enrollment is 65% of the student body (majority Hispanic), which is more than the state average of 61%. South University-The Art Institute Of Dallas is one of 19 community colleges within Dallas County, TX. Finances and Admission The public in-state tuition of $17,668 is more than the state average of $4,070. The in-state tuition has stayed relatively flat over four years. The public out-state tuition of $17,668 is more than the state average of $6,270. The out-state tuition has stayed relatively flat over four years. In-State Tuition Fees $17,668 $4,070 Out-State Tuition Fees $17,668 $6,270 % Students Receiving Some Financial Aid 96% 83% Median Debt for Graduates $25,167 $9,500 Median Debt for Dropouts $6,334 $5,250 Acceptance Rate 50% 75% Source: 2016 (or latest year available) IPEDS School Notes The Art Institute of Dallas is a design, media arts and culinary arts post-secondary school offering bachelor's and associate's degrees in Culinary Arts, Graphic Design, Advertising, Interior Design, Digital Media Production, Video Production, Fashion Design, Interactive Media Design and Media Arts & Animation. The school is one of over 40 Art Institutes located in major cities throughout North America. The school was designed with the creative student in mind. Spacious classrooms and equipped studios, professional skills kitchens and both Mac and PC computer labs offer a productive working atmosphere to explore and render creativity. The school also includes a library resource center, student gallery, student deli, an art supply store, staff and faculty offices and other amenities. Also on campus is the Chef's Gallery, a restaurant open to the public that's operated by senior level culinary students and overseen by professional chef faculty. The Art Institute of Dallas helps prepare its students for the competitive marketplace by teaching real-world, professional skills and directs students' portfolio development and professional resume creation. The Art Institute of Dallas is accredited by the Commission on Colleges of the Southern Association of Colleges and Schools to award Associate of Applied Science, Associate of Arts, Associate and Bachelor of Fine Arts degrees. Although California’s real estate may be soft, the state’s community college constructions projects are booming. Learn about where the $1.6 billion is going and how community colleges are improving their facilities. Be surprised by the results from the first ever national community college survey, which found that students value their internet connection more than their instructors! Quick Stats Students: 1,155 students In-state tuition: $17,668 Out-state tuition: $17,668 Acceptance Rate: 50% Student:teacher ratio: 21:1 Minority enrollment: 65% Did You Know? For Dallas public community colleges, the average tuition is approximately $5,875 per year for in-state students and $7,186 for out-of-state students. For private community colleges, the average yearly tuition is approximately $13,901 per year. Read more about average community college tuition costs across the country.

{#sp1 .423} {#sp2 .424} {#sp3 .425} {#sp4 .426} {#sp5 .427} {#sp6 .428} {#sp7 .429} {#sp8 .430} {#sp9 .431} {#sp10 .432} {#sp11 .433} {#sp12 .434} {#sp13 .435} {#sp14 .436} {#sp15 .437} {#sp16 .438} {#sp17 .439} {#sp18 .440} {#sp19 .441} {#sp20 .442} {#sp21 .443} {#f1 .424} {#f2 .440}

Abstract Rapid Judgments (RJs) are quick assessments based on indirect verbal and nonverbal cues that are known to be associated with deception. RJs are advantageous because they eliminate the need for expensive detection equipment and only require minimal training for coders with relatively accurate judgments. Results of testing on two different datasets showed that trained coders were reliably making RJs after watching both long and short interaction segments but their judgments were not more accurate than the expert interviewers. The RJs did not discriminate between truth and deception as hypothesized. This raises more questions about the conditions under which making RJs from verbal and nonverbal cues achieves accurate detection of veracity. title = "The Viability of Using Rapid Judgments as a Method of Deception Detection", abstract = "Rapid Judgments (RJs) are quick assessments based on indirect verbal and nonverbal cues that are known to be associated with deception. RJs are advantageous because they eliminate the need for expensive detection equipment and only require minimal training for coders with relatively accurate judgments. Results of testing on two different datasets showed that trained coders were reliably making RJs after watching both long and short interaction segments but their judgments were not more accurate than the expert interviewers. The RJs did not discriminate between truth and deception as hypothesized. This raises more questions about the conditions under which making RJs from verbal and nonverbal cues achieves accurate detection of veracity.", T1 - The Viability of Using Rapid Judgments as a Method of Deception Detection AU - Dunbar, Norah E. AU - Jensen, Matthew L. AU - Harvell-Bowman, Lindsey A. AU - Kelley, Katherine M. AU - Burgoon, Judee K. PY - 2017/4/3 Y1 - 2017/4/3 N2 - Rapid Judgments (RJs) are quick assessments based on indirect verbal and nonverbal cues that are known to be associated with deception. RJs are advantageous because they eliminate the need for expensive detection equipment and only require minimal training for coders with relatively accurate judgments. Results of testing on two different datasets showed that trained coders were reliably making RJs after watching both long and short interaction segments but their judgments were not more accurate than the expert interviewers. The RJs did not discriminate between truth and deception as hypothesized. This raises more questions about the conditions under which making RJs from verbal and nonverbal cues achieves accurate detection of veracity. AB - Rapid Judgments (RJs) are quick assessments based on indirect verbal and nonverbal cues that are known to be associated with deception. RJs are advantageous because they eliminate the need for expensive detection equipment and only require minimal training for coders with relatively accurate judgments. Results of testing on two different datasets showed that trained coders were reliably making RJs after watching both long and short interaction segments but their judgments were not more accurate than the expert interviewers. The RJs did not discriminate between truth and deception as hypothesized. This raises more questions about the conditions under which making RJs from verbal and nonverbal cues achieves accurate detection of veracity.

77 So.2d 641 (1954) STATE of Alabama v. ROBINSON LAND & LUMBER COMPANY OF ALABAMA, Inc. 1 Div. 572. Supreme Court of Alabama. November 4, 1954. Rehearing Denied February 10, 1955. *642 Si Garrett, Atty. Gen., and H. Grady Tiller, Asst. Atty. Gen., for appellant. Smith, Hand, Arendall & Bedsole, Mobile, for appellee. CLAYTON, Justice. This appeal by the state from an adverse ruling on demurrer concerns a certain formula used by the State Department of Revenue for computing corporation income taxes due the state under certain conditions. The question for our determination is whether this formula is in accordance with or runs counter to Section 390 of Title 51, Code of Alabama, 1940, which reads as follows: *643 "§ 390. Credit for taxes paid on income from sources without the state. —(a) For the purpose of ascertaining the income tax due under the provisions of this chapter, by residents of Alabama whose gross income as defined herein is derived from sources both within and without the State of Alabama, there shall be allowed a credit against the amount of tax found to be due by such resident, on account of income derived from without the State of Alabama, the amount of income tax actually paid by such resident to any state or territory on account of business transacted or property held without the State of Alabama. (b) In case the amount of tax actually paid by a resident of Alabama to another state or territory is in excess of the amount that would be due on the same income computed on the income tax rate in Alabama, then only such amount as would be due in this state on such taxable income shall be allowed as a credit. (c) If the amount of income tax actually paid by a resident of this state to any other state or territory on account of business transacted or property held, is less than the amount of tax that would be due, as computed on Alabama income tax rates, then the income tax levied herein shall be computed on the entire taxable income from sources from both within and without the state as defined herein, and the tax shall be paid less the credit allowed in this section for tax paid on income derived from without the state. (d) Before a resident of Alabama may claim the credit allowed under this section he shall file with his tax return a certificate showing amount of gross and net income derived from sources without this state together with the amount of tax paid or to be paid on such income. The words `residents of Alabama' as used in this section shall include corporations organized and existing under the laws of the State of Alabama." Appellee is an Alabama corporation with operations in Alabama and Mississippi. Its corporation income tax return filed with the State of Alabama for the year 1949 showed an aggregate gross income of $179,243.89, of which $26,780.50 was gross income from operations within the State of Mississippi. After legal and proper deductions, on its Mississippi operations, its net income in that state was $20,656.62. But its aggregate operating or business expenses for the year amounted to $161,889.72, leaving its net earnings or taxable income from all sources for the year to be $17,354.17. The correctness of the foregoing figures is not questioned on this appeal. Extending these calculations a step further and using round numbers, it is seen that although appellee's net income in Mississippi for the year was $20,000, its aggregate net income for the year in Alabama and Mississippi together was only $17,000, from which, by simple arithmetic, it is apparent that its Alabama operations standing alone showed a net loss of approximately $3,000. The Mississippi income tax rate on corporations is on a sliding scale, beginning at 1% on the first $4,000 and reaching 5% on the higher brackets. On its net income of $20,656.62 in that state, in the year 1949, appellee actually paid to the State of Mississippi income tax in the amount of $672.83. Appellee, on its income tax return to the State of Alabama for the year 1949, computed the tax at 3% on its aggregate total net income from all sources ($17,354.17) to be $520.63. It, then, computed its net income earned in the State of Mississippi ($20,656.62) at the Alabama tax rate of 3% in accordance with its version of the meaning of subsection (b) of section 390, and obtained the result of $619.70 as a credit against its income tax liability to the State of Alabama for the year. From this appellee determined that no income tax was due the State of Alabama for that year, for the reason that its Alabama income tax computed on its total aggregate net income for the year from all sources was less than the product of its income derived from business transacted *644 in Mississippi multiplied by the Alabama tax rate. The State Department of Revenue made an assessment against the taxpayer based upon its formula, or rule of thumb, as follows: It computed the taxpayer's income tax at the Alabama rate of 3% upon $17,354.17, the aggregate net income after lawful deductions and expenses, from all sources from within and without the state, and obtained a figure of $520.63. Up to this point its actions coincided with those of the taxpayer, but it then made a further computation whereby it converted taxpayer's gross income in Mississippi ($26,780.50) into a decimal fractional part of the taxpayer's aggregate gross income from all sources ($179,243.89), and obtained the fraction .14941. Multiplying this fraction by the $520.63, obtained above as tax on total net income from all sources, a figure of $77.79 was reached as a maximum allowable credit (on account of income tax paid to the State of Mississippi for the year) to be deducted from the taxpayer's Alabama income tax, based upon aggregate income from all sources. Upon the taxpayer's refusal to accede to this calculation, the State Department of Revenue made a final assessment against it of $442.84 plus interest, this being the remainder after subtracting $77.79 from $520.63. Taxpayer paid this under protest and filed its appeal by bill of complaint with copy of its tax return attached thereto in the Circuit Court of Mobile, in Equity, in accordance with Section 140, Title 51, Code of 1940. The State Department of Revenue, by demurrer, admitted the correctness of all the aforestated figures contained in appellee's tax return, but asserted that its own percentage formula and the assessment based thereon were a correct interpretation and application of Section 390 of Title 51 of the Code. The trial court ruled with the taxpayer and the state appeals. This is a case of first impression in this jurisdiction. In its brief filed in this cause, on appeal, the State Department of Revenue argues that in view of the fact that this particular section of our Income Tax Law, here involved, has not heretofore been before our appellate courts for review, the construction of that statute by the State Commissioner of Revenue should be accorded consideration in arriving at our decision in the instant case. And, in support of this proposition, he cites a number of authorities. Dixie Coaches, Inc. v. Ramsden, 238 Ala. 285, 190 So. 92; Birmingham Paper Co. v. Curry, 238 Ala. 138, 190 So. 86; State v. Tuscaloosa Building & Loan Ass'n, 230 Ala. 476, 161 So. 530, 99 A.L.R. 1019; Wetmore v. State, 55 Ala. 198; State v. Board of School Commissioners, 183 Ala. 554, 63 So. 76; Shepherd v. Sartain, 185 Ala. 439, 64 So. 57; State Board of Administration v. Jones, 212 Ala. 380, 102 So. 626; State v. H. M. Hobbie Grocery Co., 225 Ala. 151, 142 So. 46; State ex rel. Fowler v. Stone, 237 Ala. 78, 185 So. 404; Cole v. Gullatt, 241 Ala. 669, 4 So.2d 412; 42 Am.Jur., §§ 77-85, pp. 392-413; 42 Am.Jur., pp. 407, 408. Appellee's position on the other hand, is that the statute is clear, no ambiguity exists therein; the legislative intent is plain and no occasion arises for any construction other than the usual meaning of the words in the clearly expressed language of the statute. State v. Praetorians, 226 Ala. 259, 146 So. 411; Holt v. Long, 234 Ala. 369, 174 So. 759; Bozeman v. State, 7 Ala.App. 151, 61 So. 604, certiorari denied Ex parte Bozeman, 183 Ala. 91, 63 So. 201; Ex parte Bozeman, 183 Ala. 91, 63 So. 201; Gibbs v. State, 29 Ala.App. 113, 192 So. 514, certiorari denied 238 Ala. 592, 192 So. 515; State v. Tuscaloosa Building & Loan Ass'n, 230 Ala. 476, 161 So. 530, 99 A.L.R. 1019, supra; May v. Head, 210 Ala. 112, 96 So. 869. As the case is before us on demurrer, no testimony was taken, and no allegations appear in the pleadings in regard to the interpretation or construction given to this section of the statute by the State Commissioner of Revenue, this matter is not before us, as we do not take judicial notice of his decisions. But this aside, the law is clear that "When the language as used by the lawmakers is plain, it is the *645 duty of the courts to obey; no discretion is left; and courts should not stray into bypaths or search for reasons outside of the plain letter of the law upon which to rely for the purpose of giving a different meaning or interpretation, for "when the language is plain it should be considered to mean exactly what it says."— State ex rel. Little v. Foster, 130 Ala. [154] 163 (30 So. 477)." Ex Parte Bozeman, supra [183 Ala. 91, 63 So. 203]; Dixie Coaches, Inc. v. Ramsden, supra; State v. Tuscaloosa Building & Loan Ass'n, supra; State Board of Administration v. Jones, supra. Argument is made that in view of the fact that much of our Income Tax Law, including section 390, supra, in part, was taken from the Federal Income Tax Law, we should follow the construction placed on the Federal law by the United States courts. In the case of State v. Flenner, 236 Ala. 228, 181 So. 786, 787, this court, speaking through Knight, J., made the following comment: "While the construction placed upon a similar provision of the Federal Income Statute, or by the Courts of New York, Massachusetts, Wisconsin and Georgia, upon similar provisions in their respective statutes, are not binding upon this Court, yet the decisions of those courts are justly entitled to weight. Particularly is this true with reference to the decisions of the Supreme Court of the United States when it is remembered that the Alabama Act was borrowed from the Federal statute, and after the Supreme Court of the United States had passed upon, and construed the same. "The Legislature of Alabama has deliberately and substantially used in the Acts now before us practically the same language employed in the pertinent provisions by the Congress in adopting the Federal Income Tax law. It was no accidental happening. While this Court will not abdicate its jurisdiction in construing and determining the meaning of an act of its own state legislature, yet this Court recognizes the legislative presumption that obtains here, as well as elsewhere, that, in borrowing an Act of the Legislature of another state, which had received a settled construction in that state before enacted here, it was the purpose of the Legislature in so adopting the statute that the construction placed on the same by the highest court of the state of original enactment should be given the statute, unless there appears something in the act as enacted here to show a contrary purpose. We know this rule is not absolute, or controlling, but it is at least persuasive. Alabama Fuel & Iron Co. v. Denson, 208 Ala. 337, 94 So. 311." [Emphasis supplied.] Likewise, the state cites the California case of Miller v. McColgan, 17 Cal.2d 432, 110 P.2d 419, 134 A.L.R. 1424, as the only case found reported from a court of last resort where the question of credit for income tax paid on income from without the state was involved. The annotations found under that case in A.L.R. are very full and have been helpful in the preparation of the present opinion. Accordingly, we set out here the corresponding section of the California statute for the purposes of differentiation later in this discussion: Section 25, California Personal Income Tax Act 1935, Statutes 1935, p. 1117. "Sec. 25. Credit for Taxes Paid Other States by Resident or Nonresident Taxpayers. "(a) Whenever a resident taxpayer of this State has become liable to income tax to another State or country upon his net income, or any part thereof, for the taxable year, derived from sources without this State, and subject to taxation under this act, the amount of income tax payable by him under this act shall be credited with the amount of income tax so paid by him to such other State or country, but such credit shall not exceed such proportion of the tax payable under this act as the income subject to tax in such other State or country bears to the taxpayer's entire income upon which *646 the tax is imposed by this act. * *" [Emphasis supplied.] Our first effective income tax law, that of 1933, imposed a tax on incomes beginning with the year 1933 and contained no section corresponding to the present section 390 of Title 51, Code of 1940. The case of State v. Weil, 232 Ala. 578, 584, 585, 168 So. 679, 685, held: "* * * it seems reasonably clear that the legislative intent was to impose the tax on residents, natural persons, and corporations, within the state's jurisdiction in respect to their entire net income, from whatsoever source derived, * * *. * * * * * * "The interpretation which we have given the act rendered taxable incomes derived by the taxpayer, as a member of the partnership of Weil Brothers, from sales of cotton consummated during the year 1933, outside this state. So, also, from cotton purchased and sold outside of the state by said partnership resident of this state." Although the decision in the Weil case, supra, was not handed down by this court until 1936, the proceedings began in the early part of 1935. That case probably was responsible in some measure for the incorporation of Section 345.16 in the General Revenue Act of 1935, Gen.Acts 1935, p. 410, appvd. July 10, 1935, now Section 390, Title 51, supra. The last sentence "The words `residents of Alabama' as used in this section shall include corporations organized and existing under the laws of the State of Alabama" was added by the Code Committee of 1940. Certain it is that before the passage of Section 390, supra, any Alabama taxpayer with income derived from business transacted in another state was required by our 1933 Income Tax Law to pay Alabama income tax on that income regardless of the fact that such taxpayer might have paid income tax on such identical income to the state in which such income was derived. State v. Weil, supra. Unquestionably the legislative purpose in the adoption of the credit provision in our statute, as well as those in the Federal statute was to relieve the taxpayer of the burden of double taxation. Burnet v. Chicago Portrait Co., 1932, 285 U.S. 1, 52 S.Ct. 275, 76 L.Ed. 587, affirming Commissioner of Internal Revenue v. Chicago Portrait Co., 7 Cir., 1931, 50 F.2d 683, which affirms 1929, 16 B.T.A. 1129; Hubbard v. U. S., 1936, 17 F.Supp. 93, 84 Ct.Cl. 205, writ of certiorari denied in 1937, 300 U.S. 666, 57 S.Ct. 508, 81 L.Ed. 873, 874. But, in order that payment by a resident taxpayer of taxes paid to another state or country on income derived from transactions within such other state or country might not relieve the taxpayer from payment of domestic taxes on his domestic income, limiting provisions have been added to all the statutes which have come to our attention. In California such limitation is as follows: "* * * but such credit shall not exceed such proportion of the tax payable under this act as the income subject to tax in such other State or country bears to the taxpayer's entire income upon which the tax is imposed by this act." Two limitations are contained in the Federal statute, viz.: The credit shall not exceed the same proportion of the tax against which such credit is taken as the taxpayer's net income from sources within such country bears to his entire net income for the same taxable year; and, the credit shall not exceed the same proportion of the tax against which such credit is taken as the taxpayer's net income from sources without the United States bears to his entire net income for the same taxable year. While the credit provision contained in Section 390, Title 51, supra, is substantially the same as is found in the Federal and California income tax laws, the limitations thereon are greatly different, as will be seen readily from a reading of the quoted parts hereinabove. *647 Section 390(a), Title 51, supra, standing alone, undoubtedly, grants to the taxpayer for the amount actually paid to another state full credit against his income tax payable to the State of Alabama. The wording "the amount of income tax actually paid by such resident to any state or territory on account of business transacted or property held without the State of Alabama" means paid under the laws of the other state or territory. What deductions for business expenses from the gross income flowing to taxpayer on account of business transacted in such other state, in order to calculate the net taxable income in that state, must necessarily be governed by the applicable statute of that other state. Subsection (b) of Section 390, supra, is the safeguard which prevents loss of income tax revenue by the State of Alabama on business transacted within Alabama by reason of credit under subdivision (a) of Section 390, supra, for payments actually paid to another state at a rate higher than our own on business transacted within such other state. For example, assume that an Alabama corporation has taxable income derived within Alabama of $10,000 and also taxable income of $10,000 on account of business transacted in another state in which the income tax rate is 6%; in the absence of subsection (b), supra, payment of $600 income tax to the other state would deprive Alabama of any income tax revenue on the $10,000 income of the corporation derived within the State of Alabama. This is the reason for subsection (b), Section 390, Title 51, Code of Alabama 1940. For emphasis, subsection (b), supra, is here quoted alone: "(b) In case the amount of tax actually paid by a resident of Alabama to another state or territory is in excess of the amount that would be due on the same income computed on the income tax rate in Alabama, then only such amount as would be due in this state on such taxable income shall be allowed as a credit." Reduced to words, the formula which the State Department of Revenue has used as an interpretation and application of subsection (b), Section 390, supra, is: But such credit shall not exceed such proportion of the tax payable under this act as the gross income of the taxpayer derived in such other state or territory bears to his entire gross income derived from all sources both within and without Alabama. The effect of the application of the State Department of Revenue's formula is to accomplish the very thing which Section 390, supra, was designed to avoid, namely, the imposition of two state income taxes upon one income. Section 390 of the income tax statute contains no such limitation. It is not within the power of the State Department of Revenue to add or take from the statute by administrative construction. 42 Am.Jur. p. 400, § 80. Only the legislative branch of our state government is vested by the Constitution with lawmaking power. The words of this court, speaking through Simpson, J., in State v. Travelers Ins. Co., 256 Ala. 61, 68, 53 So.2d 745, 750, and quoted below, might well be applied to the instant situation: "But the Department must stay within the confines of the constitutional and statutory mandates. International Paper Co. v. Curry, 243 Ala. 228, 9 So.2d 8; Panama Refining Co. v. Ryan, 293 U.S. 388, 55 S.Ct. 241, 79 L.Ed. 446. The basis of this tax act is therein clearly defined * * *. The use of an illusory formula by the Department, which has no tendency to show the amount of this basis, results in an unconstitutional delegation—or more accurately, usurpation—of legislative authority. This would be but allowing the Department to fix its own standards different from those of the statute, * * *. This is not constitutionally permissible. Phenix City v. Alabama Power Co., 239 Ala. 547, 195 So. 894; Panama Refining Co. v. Ryan, supra." *648 As the Mississippi income tax rate is higher in the present instance than the Alabama rate, no incentive would appear for the taxpayer to charge against its Mississippi operation less than its lawful share of his overhead costs and other business expense, but as the case is before us only on the state's demurrer to the taxpayer's bill of complaint, no question is presented in that regard. The decree of the circuit court overruling the state's demurrer to appellee's bill of complaint was proper and is affirmed. Affirmed. LIVINGSTON, C. J., and SIMPSON and STAKELY, JJ., concur.

// MARK: JSON public enum JSON { case string(Swift.String) case number(Double) case bool(Swift.Bool) case null case array([JSON]) case object([Swift.String : JSON]) } // MARK: RawRepresentable extension JSON: RawRepresentable { public init?(rawValue: Any) { switch rawValue { case let v as Swift.String: self = .string(v) case let v as DoubleType: self = .number(v.double) case let v as Swift.Bool: self = .bool(v) case is (): self = .null case let v as [JSON]: self = .array(v) case let v as [Swift.String : JSON]: self = .object(v) default: return nil } } public var rawValue: Any { switch self { case let .string(v): return v case let .number(v): return v case let .bool(v): return v case .null: return () case let .array(v): return v case let .object(v): return v } } } // MARK: Equatable extension JSON: Equatable {} public func == (lhs: JSON, rhs: JSON) -> Bool { switch (lhs, rhs) { case let (.string(l), .string(r)): return l == r case let (.number(l), .number(r)): return l == r case let (.bool(l), .bool(r)): return l == r case (.null, .null): return true case let (.array(l), .array(r)): return l == r case let (.object(l), .object(r)): return l == r default: return false } } // MARK: CustomStringConvertible extension JSON: CustomStringConvertible { public var description: Swift.String { switch self { case let .string(v): return ".string(\(v))" case let .number(v): return ".number(\(v))" case let .bool(v): return ".bool(\(v))" case .null: return ".null" case let .array(v): return ".array(\(v.description))" case let .object(v): return ".object(\(v.description))" } } } // MARK: Accessors extension JSON { public subscript(index: Int) -> JSON? { return self.rawArray?[index] } public subscript(key: Swift.String) -> JSON? { return self.rawObject?[key] } public var rawString: Swift.String? { switch self { case let .string(v): return v default: return nil } } public var rawNumber: Double? { switch self { case let .number(v): return v default: return nil } } public var rawBool: Swift.Bool? { switch self { case let .bool(v): return v default: return nil } } public var rawNull: ()? { switch self { case .null: return () default: return nil } } public var rawArray: [JSON]? { switch self { case let .array(v): return v default: return nil } } public var rawObject: [Swift.String : JSON]? { switch self { case let .object(v): return v default: return nil } } public var jsonString: Swift.String { switch self { case let .string(v): return "\"\(v)\"" case let .number(v): return "\(v)" case let .bool(v): return "\(v)" case .null: return "null" case let .array(v): let valuesString = v.reduce("") { ($0 == "" ? "" : $0 + ", ") + $1.jsonString } return "[ " + valuesString + " ]" case let .object(v): let keyValuesString = v.reduce("") { ($0 == "" ? "\"" : $0 + ", \"") + $1.0 + "\" : " + $1.1.jsonString } return "{ " + keyValuesString + " }" } } } // MARK: JSON.ParseError extension JSON { public enum ParseError: Error { case invalidJSONFormat case typeMismatched(expected: Swift.String, actual: Swift.String) case keyNotFound(Swift.String) } }

The serum activities of AP, gamma-GT, GLDH, GPT and CHE after complete biliary obstruction and choledochocaval fistula in the rat. The activities in serum of alkaline phosphatase, gamma-glutamyltransferase, glutamate dehydrogenase, glutamic pyruvic transaminase and cholinesterase were compared after complete biliary obstruction (CBO) and choledochocaval fistula (CCF) in the rat. CCF was used as a model of complete biliary retention without bile stasis and without increased pressure in the biliary tract. The increases in AP, GLDH and gamma-GT within 24-h post-op. show no difference between the two experimental groups. The conclusion is that the retention of biliary constituents alone is responsible for the increase in the levels of serum activity and that other conditions like bile stasis and increased pressure in the biliary tract do not play an important role in the pathogenesis of these alterations. The rise of GPT activity in CCF is of a lesser degree than in CBO.

ObitTree Blog Do you want to be buried or cremated? It’s a conversation every family should have with their loved ones. One of the funeral profession’s oldest debates is when families at the funeral home have to choose between burial and cremation. How much should a funeral cost? It’s something consumers often find themselves asking after a loved one’s passing. According to the National Funeral Directors Association, the average cost of a funeral service $8508. Now with that being said, a funeral service can cost much more or much less. It all comes down to what you want to be included in the service. As difficult as it may be to hear, there’s a chance your pet might outlive you. If you’ve never considered this, you might find yourself wondering what happens to pets when their owners die? The sad truth is that thousands of pets are placed in animal shelters every year when their owner passes away.It’s a difficult situation, to say the least, and one that can be easily avoided. According to Statista, Facebook has more than 2.27 billion active monthly users. Eventually, each of those users will pass away. But what happens to Facebook after you die? Does the account get deleted? Does it just sit there dormant for people to post messages or photos the account holder will never see? Or does Facebook do something else entirely? Even though every funeral is different, most services often follow a similar funeral planning checklist. While common steps like selecting a casket, purchasing flowers, or choosing a burial plot may seem easy, there are also many common funeral planning mistakes people make during this process. Although we know that life is not infinite, it’s important to understand why it is important to have a will. If you’re unsure how to write a will, we’ve broken down the different steps involved and discussed the benefits of writing a last will and testament. Once a loved one’s remains have been cared for, you might find yourself wondering what do with ashes after cremation. What many people do not realize is there are far more options than storing the remains at home. Taking the time to plan a meaningful ash spreading ceremony can not only help you cope with grief but give your loved one a loving tribute. How do you find a funeral home in your area to work with? If your answer is to simply Google something and pick one at random, you might be missing out. Click here to learn more about choosing a funeral home. We’ve covered things to look for as well as warning signs that should turn you away. Did you know that in the 48 hours immediately following a loved one’s death, the deceased’s family could have to make up to 70 decisions? It can be an overwhelming situation, to say the least. In addition to dealing with the grief and stress of losing someone you love, you now have many important decisions to make in a limited amount of time. Click here to learn what to expect when making funeral arrangements.

In taking a scene against light or taking a scene large in luminance difference, a white-out or black-out effect may occur only with a standard image with the exposure period matched with the illuminance of photographic subject. In order to overcome this problem, two or more non-standard images having different exposure times are taken to be replaced by an image obtained by multiplying the non-standard images by a synthesis gain in the area too bright or too dark in the standard image to enlarge the dynamic range of the resultant image, which is then compressed in match with the output bit. In this case, the standard image and the non-standard image are connected by synthesized gain, so that an improper synthesized gain may cause false contouring in the boundary of connection. So, as disclosed in Japanese Patent Laid-open No. Hei 7-131708, the difference in photoelectric conversion and so on due to the difference in incident light intensity can be ignored by obtaining a synthesis gain to be multiplied by the non-standard image by a ratio between two image signals in the pixel of long/short replaced luminance level. However, if a smear occurred in a backlight scene for example, false contouring is caused by the computation of an improper synthesized gain (FIG. 1). Also, when a moving subject is taken, signals at the same pixel positions in two or more images are not always by the same subject. In this case, an improper image signal ratio is obtained, so that an improper synthesized gain is computed, resulting in false contouring.

Epicardial activation of the human ventricle: effects of left ventricular hypertrophy. To determine the effects of left ventricular hypertrophy on epicardial activation of the human heart, intraoperative epicardial mapping of 40 to 66 points was performed in 10 patients undergoing aortic valve replacement. Mean calculated left ventricular mass was 364 +/- 98 g. All patients had normal left ventricular contraction. Earliest epicardial activation occurred in the anterior right ventricle in all patients. In 9 patients, it was the only epicardial breakthrough point. One patient had a single inferior left ventricular breakthrough point. Epicardial activation spread from the right ventricle towards the left ventricle in both the anterior and inferior direction. Latest epicardial activation occurred at the base of the left ventricle in 9 patients and the base of the right ventricle in 1. When compared with patients with coronary artery disease, normal ventricular contraction, and no left ventricular hypertrophy, patients with hypertrophy had fewer left ventricular breakthrough points (p less than 0.001) and were more likely to have latest activation at the left ventricular base (p less than 0.0010. We conclude that left ventricular hypertrophy is associated with marked changes in the pattern of epicardial activation. These changes may reflect delay in spread from endocardium due to the increased wall thickness.

Evaluation of an AIDS training program for traditional healers in the Central African Republic. Training designed to improve AIDS knowledge, attitude, and practice was delivered to 96 traditional healers in the Central African Republic. The training (17 to 36 hours) was conducted by traditional healers with the assistance of staff from the Ministry of Health. Training included the following topics: prevention of HIV transmission during traditional practice; diagnosis, treatment, and prevention of sexually transmitted diseases; condom promotion; AIDS education at the community level; psychosocial support for people with AIDS; and promotion of a positive image for traditional healers. The evaluation of the training consisted of a prospective assessment of knowledge and attitude immediately prior to and after training. These assessments were conducted using structured interviews. Improvement in knowledge and/or attitudes was observed in all areas assessed except for prevention of HIV transmission during traditional practice. We concluded that AIDS training can be successfully delivered to traditional healers.

Using technology to facilitate informed consent, manage expectations and improve communication. Rising malpractice rates and damages to finances and reputations caused by litigation are leading risk managers to seek new solutions to reduce the frequency and severity of malpractice. Any effort to meet the challenges of malpractice must consider three areas: the informed consent process, expectation management and physician communication. Technology is emerging as an important tool that can help risk managers better address these critical areas. This article explores the realities of malpractice today - specifically the factors behind the majority of cases and discusses how new tools can help risk managers.

USADA Chief Travis Tygart on doping in elite sports Travis Tygart has headed the U.S. Anti-Doping Agency since 2007, he was on the front line of the doping scandal involving mega-abuser Lance Armstrong earlier this decade, and he has testified on the issue before Congress and international anti-doping organizations numerous times. I recently spoke with Tygart for a Q&A in the fall issue of Stanford Medicine magazine. We talked right after the Rio Olympics so I asked him first: What were the major lessons learned from Rio about global anti-doping efforts? “Obviously, the state-and sport-run doping system in Russia was exposed,” he told me. “I think the covering up of positive results for athletes and sending those athletes to major international competitions opened the eyes of a lot of people to the lengths that some will go in order to win.” I was curious too about what happens when athletes lose trust that their competitions are fair and drug free. How is that trust ever regained? Trust is, Tygart stressed, the key issue: “Athletes have to trust that those in the position of authority to protect their rights are doing everything they can, within the law and rules, to ensure their rights are protected. It’s the greatest injustice in sports when athletes or teams who are playing by the rules get robbed of their accomplishments, their successes or their victories because someone cheats them.” Days before the Rio games were to begin, Washington Post sports columnist Sally Jenkins called for an end to the ban on performance enhancing drugs. In her Postcolumn she wrote: Abraham Lincoln once famously said that prohibition ‘makes a crime out of things that are not crimes.’ WADA has done exactly that. Its short history traces the same path as American Prohibition: a raft of unintended consequences breeding new forms of sin greater than the sin it was supposed to stamp out — as the Russian doping crisis so amply demonstrates. Individual rights have been infringed on, money has been wasted, and gangsterism has flourished, while failing to protect the health of athletes. Looming over it all is a portentous bureaucracy that exhibits more pratfalls than a Charlie Chaplin film. Not surprisingly, Tygart vehemently disagrees with Jenkins. Legalizing doping, he believes, would begin an arms race and catapult performance enhancing drugs into the stratosphere. “…Human competition is what we want out of sport — true athletic competition, as we know it and value it. I’m the father of three young kids who play sports. I’d like to see them get and learn life lessons through sports. If we allow doping at the elite level, it’s just a matter of time before every kid in this country is having to seriously contemplate — to get a scholarship or make the varsity team or even make the junior varsity team or the eighth-grade soccer team — which of these drugs am I going to inject in myself?” More of our conversation was captured in the Q&A and this 1:2:1 podcast.

Epoxy Nanocomposites Containing Zeolitic Imidazolate Framework-8. Zeolitic imidazole framework-8 (ZIF-8) is utilized as a functional filler and a curing agent in the preparation of epoxy nanocomposites. The imidazole group on the surface of the ZIF-8 initiates epoxy curing, resulting in covalent bonding between the ZIF-8 crystals and epoxy matrix. A substantial reduction in dielectric constant and increase in tensile modulus were observed. The implication of the present study for utilization of metal-organic framework to improve physical and mechanical properties of polymeric matrixes is discussed.

Localization of intraocular foreign bodies by computed tomography. An experimental model is presented and the smallest sized metal intraocular foreign body that could be accurately detected by computed tomography was found to be 1 mm in diameter. A 1/2-mm intraocular foreign body was not detected by the computed tomography scan. Computed tomography is an effective method for the precise localization of intraocular foreign bodies.

Newsletter Signup Zimbabwe Discover the legendary Victoria Falls and Zambezi River. Go on safari in Hwange National Park to track wildlife including large herds of elephant as well as buffalo, leopard, white rhino, spotted hyena, southern giraffe, sable, blue wildebeest, impala, common waterbuck and reedbuck. Try bird watching at Lake Kariba where more than 350 species have been recorded. Travel to Mana Pools National Park in the heart of the Zambezi Valley. Zambia, Zimbabwe & Malawi Sustainable Travel Safari Tours Adventure Travel 11 Days Tour Highlights Experience Victoria Falls, the natural wonder that is part of Victoria Falls National Park, a UNESCO World Heritage Site Savor a relaxing sunset cruise on the mighty Zambezi River as it makes its way upstream towards Zambezi National Park Explore Hwange National Park, one of Zimbabwe’s premier wildlife destinations At Lake Kariba, go on enjoy early morning or late afternoon bush walks in the company of professional guides Travel to a remote camp in the heart of the Zambezi Valley to see large numbers of elephant, buffalo and eland as well as lion, leopard, cheetah, wild dog and some of the 350 species of birds Day 1: Johannesburg, South Africa On arrival, you will be met by our representative, who will present you with your travel documents before providing a private transfer to your hotel, a lovely four-star hotel set in the heart of Kempton Park, minutes from Johannesburg’s O.R. Tambo International Airport. Fashioned after an aircraft hangar, the industrial ambiance of the hotel is felt in the polished concrete floors, steel finishes, chrome lighting and floor-to-ceiling windows that overlook the air field as planes take off and land. Protea Hotel O.R. Tambo – Standard Room Day 2: Johannesburg / Victoria Falls, Zimbabwe Return to the terminal for your flight to Victoria Falls. On arrival, you clear Immigration and Customs. You are welcomed and privately transferred to your hotel. Luggage, including camera equipment and hand luggage, is restricted to (44 lbs) per person. Take a step back in time at The Victoria Falls Hotel, the “grand old lady of the Falls.” Situated perfectly in the fabulous Victoria Falls National Park, a UNESCO World Heritage Site, it offers easy access to the breathtaking curtain of water. This afternoon, you will enjoy a sunset cruise on the mighty Zambezi River. The boat gently makes its way upstream towards Zambezi National Park, usually accompanied by a brief talk about the river and its wildlife by your skipper. You relax and enjoy the riverine vegetation and spot the excellent birdlife as well as hippo and occasional crocodile. In the drier months, wildlife such as elephant and a variety of antelope species graze on the riverbanks or swimg across to the smaller islands. This iconic river is the fourth largest in Africa, and its source is in northwestern Zambia. This wide river is dotted with islands and sandbanks and is bordered on the Zimbabwean side by the Zambezi National Park. The two-hour cruise offers comfortable safari chairs, tables, and bar service. Victoria Falls Hotel – Stable Wing Room (B) Day 3: Victoria Falls Today you witness the power and grandeur of Victoria Falls is one of the seven natural wonders of the world. David Livingstone was famous as the first European to visit the falls, naming it after Queen Victoria. It’s indigenous name is “Mosi-oa-Tunya” – The Smoke that Thunders, an accurate description of what happens when the Zambezi River plunges over the deep chasm, creating a shower of spray and that thunderous sound. From February to May, the falls are in full flood, and 500 million liters/113,510,372 gallons of water tumble over the edge into a series of gorges each minute! After a briefing and explanation of the falls, your guide accompanies you along the scenic pathways of the rainforest, stopping at numerous dramatic viewpoints. Victoria Falls Hotel – Stable Wing Room (B) Day 4: Victoria Falls / Hwange National Park A private road transfer takes you to Victoria Falls Airport, where you board your charter flight to Hwange airstrip for Davisons Camp. Within Zimbabwe’s premier wildlife and conservation area, your camp is one of the few located within the park boundaries. The camp’s nine en-suite tents offer complete privacy as well as a compelling mix of diverse wildlife. From the comfort of your veranda, you will be able to watch the continuous procession of game at the waterhole. Davisons Camp – Tented Room (B,L,D) Day 5: Hwange National Park Davisons Camp is situated in the Linkwasha Concession, a remote northeastern corner of Hwange National Park. Named after the founder of the park and its first warden, Ted Davison, the camp overlooks an active waterhole that attracts a variety of plains game and predators. Game viewing is excellent year-round in the concession, including lion, large herds of elephant, buffalo, leopard, white rhino, spotted hyaena, southern giraffe, sable, blue wildebeest, impala, common waterbuck and reedbuck. Open plains areas make for excellent game viewing. In summer, wildebeest, zebra and eland are found in abundance here; while in winter, the waterholes are magnets around which elephant in enormous numbers congregate. Birdlife in the area is prolific and varied, with over 400 species to be seen. Game activities include game drives or guided walks in the early mornings and evenings when the animals are most active. Davisons Camp – Tented room (B,L,D) Day 6: Hwange National Park / Lake Kariba Depart Hwange on your charter flight to Lake Kariba, where you will be met by a Changa Safari Camp representative. A 20-minute boat transfer takes you across the lake to your luxury tented camp on the shores of Lake Kariba. The camp is within a small, private concession in the northeastern section of the Matusadona National Park that offers magnificent views looking out across Hydro Bay towards the Matusadona Mountains. The camp has just six large, East African-style luxury canvas tents, all overlooking the lake. Each tent has its own en-suite bathroom, with indoor/outdoor shower and outdoor bathtub, all heated by gas that allows for hot water all day. All tents are mosquito-proofed and have fans. The central guest area consists of several thatched structures linked together by raised wooden walkways and decks, and includes a lounge library, dining room, bar, beautiful deck and swimming pool overlooking Lake Kariba. Changa Camp – Deluxe Tent (B,L,D) Day 7: Lake Kariba Leopard, lion, hyena and cheetah are found in the area as well as elephant, hippo and a multitude of antelope species. The birdlife here is prolific, with more than 350 species have been recorded. This is also a walker’s paradise. Early morning or late afternoon walks in the company of one of the camp’s professional guides are a special feature of this camp. You also have opportunities for game drives or cruises and fishing in the lake. Changa Camp – Deluxe Tent (B,L,D) Day 8: Lake Kariba / Mana Pools National Park Today you fly via charter flight to Mana West Airstrip. A short road transfer takes you to your remote camp on the banks of the Zambezi River with the imposing Great African Rift Valley within view. Large numbers of elephant, buffalo and eland come to the river as do lion, leopard, cheetah and wild dog. Enjoy stunning views from your spacious en-suite tent. Your secluded outdoor 'bath-with-a-view' will be an experience you will long cherish. Low-level walkways connect the ten guest tents to the beautifully designed central dining, bar, library and lounge areas. A separate deck sports an infinity pool for swimming and sunbathing, and an inviting, cushion-strewn star-gazing deck. Ruckomechi Camp – Tented R (B,L,D) Days 9/10: Mana Pools National Park Mana Pools National Park is in the heart of the Zambezi Valley. The camp is set among a large grove of acacia and ebony trees that is rich with birds and varied wildlife. In the dry season, large herds of elephant and buffalo together with hippo, waterbuck, kudu, nyala and eland all gather along the riverbanks. Cheetah and endangered wild dog are also often seen. The area is equally famous for some 350 species of birds including collared palm thrush and African skimmer, purple-banded sunbird and racket-tailed roller. Activities include early morning walks with an experienced guide, morning and afternoon game drives, night drives, canoeing and catch-and-release fishing. Ruckomechi Camp – Tented R (B,L,D) Day 11: Mana Pools / Harare / Johannesburg / Depart Your final morning game drive ends at the airstrip where you board your flight to Harare, and connect with your scheduled flight to Johannesburg. On arrival you check in for your onward flight home. (B) Land price, per person, double occupancy: From $700 per person per day. Internal airfare additional. Tour Inquiry Form Request more information now! We will be happy to answer any questions you may have regarding our tours.

LOUISE PLACHTA: Obeying my instincts Tuesday, April 2, 2013 Do you ever get a feeling that you just have to call a friend or brother, sister, or someone that you haven’t talked with in a long time? I don’t think I have extrasensory perception, but every so often, my conscience nags at me until I either capitulate and call, or dismiss the feeling and later regret later that I had not acted on it. Two recent incidents come to mind. I had not talked with Frances for 40-plus years – ever since she and her husband taught our younger daughter to drive a two-wheel bicycle. Laura had spent a week with our friends while the rest of our family travelled to a conference in New Orleans. We have exchanged Christmas letters, birthday and anniversary cards and, now and then, quick notes. This past holiday season, for whatever reason, I didn’t send my annual Christmas/Thanksgiving/New Year/Valentine letter to family and friends. (To clarify:The letter is titled for whenever I finally get around to mailing it.) But I did send a few Valentine cards – to let people know that I was still alive and kicking. In late February, as I addressed an anniversary card to my friends in Warren, I had a feeling that I should wait to seal the envelope until I was ready to send it. Sometime in March, a note came from Frances. She thanked me for the Valentine greeting and added a postscript: “Didn’t I write you at Christmas that Stanley had died last August?” Much to my dismay, I had overlooked her note in the Christmas card. I did not send the anniversary wishes, but did send Frances a note of condolence and promised that I would call her sometime during the week after Easter. On another occasion, I had been thinking about someone whom I had not seen for almost two years, someone I had known at the university. Three days of sunshine and the general excitement of Easter preparations were the nudge I needed to contact Adelyn,I was a bit apprehensive about calling because Addy is a shy, unassuming lady somewhere in her later 70s and, like many of us, not too anxious to have visitors at a moment’s notice. I had a cheerful yellow daffodil that I thought would brighten her small apartment. As expected, Addy made excuses in an effort to dissuade my visit. However, I wouldn’t take “No” for an answer and offered that I would stay for just a minute, and then quickly said my goodbye. My dear friend answered the door within seconds of my ringing the doorbell. I handed her the plant, which she admired and set on the kitchen table. I wished her a Happy Easter and turned to leave (after all, I was going to stay for just a minute) but she invited me to stay a while. An hour and a half passed while we discussed everything from Buyers’ Guides thrown on lawns instead of porches, the Pope’s election, the high costs of television use, technology’s pros and cons, and babushkas. We also wondered about colleagues that we had not seen for years. I didn’t want to wear out my welcome so I rose and headed for the door. We hugged and promised to keep in better touch with each another. On the drive home, I gloried in the sunlight and the warmth of a Michigan spring day; and I thanked whatever power it was that had made me call and subsequently visit with Addy. She had made a good day for me. I hope I had made one for her as well. Louise Plachta is a Morning Sun columnist and can be reached at [email protected].

British English sample American English sample See Inside Book information Age 5+ CEFR Level A2 Paperback RRP: £6.99ISBN: 9781474927833Extent: 40 pagesDimensions: 240 x 170mm Illustrator Rose Frith Author information Mairi Mackinnon has lived in England, Scotland, France, Italy and Spain, and worked as an English teacher, translator and tour manager before joining Usborne. Over the years, she has edited Usborne books in English, Arabic, Chinese, Dutch, French, German, Hebrew, Irish, Italian, Japanese, Latin, Polish, Portuguese, Russian, Spanish and Welsh. She has worked extensively on books for beginner readers, such as Usborne Very First Reading, and developed the Usborne English Readers series for young English language learners. She has also worked on the Usborne Foundation’s popular phonics game, Teach your Monster to Read.

The present invention deals with a system for treating an aneurysm. More specifically, the present invention deals with a removable occlusion system deployed in the vasculature containing the aneurysm. Several methods of treating aneurysms have been attempted, with varying degrees of success. For example, open craniotomy is a procedure by which an aneurysm is located, and treated, extravascularly. This type of procedure has significant disadvantages. For example, the patient undergoing open craniotomy must undergo general anesthesia. Also, the patient undergoes a great deal of trauma in the area of the aneurysm by virtue of the fact that the surgeon must sever various tissues in order to reach the aneurysm. In treating cerebral aneurysms extravascularly, for instances, the surgeon must typically remove a portion of the patient""s skull, and must also traumatize brain tissue in order to reach the aneurysm. Other techniques used in treating aneurysms are performed endovascularly. Such techniques typically involve attempting to form a mass within the sac of the aneurysm. Typically, a microcatheter is used to access the aneurysm. The distal tip of the micro catheter is placed within the sac of the aneurysm, and the microcatheter is used to inject embolic material into the sac of the aneurysm. The embolic material includes, for example, detachable coils or an embolic agent, such as a liquid polymer. The injection of these types of embolic materials suffer from disadvantages, most of which are associated with migration of the embolic material out of the aneurysm into the parent artery. This can cause permanent and irreversible occlusion of the parent artery. For example, when detachable coils are used to occlude an aneurysm which does not have a well defined neck region, the detachable coils can migrate out of the sac of the aneurysm and into the parent artery. Further, it is, at times, difficult to gauge exactly how full the sac of the aneurysm is when detachable coils are being injected. Therefore, there is a risk of overfilling the aneurysm in which case the detachable coils also spill out into the parent artery. Another disadvantage of detachable coils involves coil compaction over time. After filling the aneurysm, there remains space between the coils. Continued hemodynamic forces from the circulation act to compact the coil mass resulting in a cavity in the aneurysm neck. Thus, the aneurysm can recanalize. Embolic agent migration is also a problem. For instance, where a liquid polymer is injected into the sac of the aneurysm, it can migrate out of the sac of the aneurysm due to the hemodynamics of the system. This can also lead to irreversible occlusion of the parent vessel. Techniques have been attempted in order to deal with the disadvantages associated with embolic material migration to the parent vessel. Some such techniques, commonly referred to as flow arrest techniques, typically involve temporarily occluding the parent vessel proximal of the aneurysm, so that no blood flow occurs through the parent vessel, until a thrombotic mass has formed in the sac of the aneurysm which helps reduce the tendency of the embolic material to migrate out of the aneurysm sac. However, thrombotic mass can dissolve through normal lysis of blood. Also, in certain cases, it is highly undesirable to occlude the parent vessel even temporarily. Therefore, this technique is, at times, not available as a treatment option. In addition, even occluding the parent vessel may not prevent all embolic material migration into the parent vessel. Another endovascular technique for treating aneurysms involves inserting a detachable balloon into the sac of the aneurysm using a microcatheter. The detachable balloon is then inflated using saline and/or contrast fluid. The balloon is then detached from the microcatheter and left within the sac of the aneurysm in an attempt to fill the sac of the aneurysm. However, detachable balloons also suffer disadvantages. For example, detachable balloons, when inflated, typically will not conform to the interior configuration of the aneurysm sac. Instead, the detachable balloon requires the aneurysm sac to conform to the exterior surface of the detachable balloon. Thus, there is an increased risk that the detachable balloon will rupture the sac of the aneurysm. Further, detachable balloons can rupture and migrate out of the aneurysm. A system for treating an aneurysm in a vessel includes a delivery device having a delivery portion suitable for delivery of embolic material. The delivery device is placed in a neck of the aneurysm and an expandable member is placed proximate the neck. The expandable member is expanded to overlie substantially the entire neck. Embolic material is delivered to the aneurysm with a delivery device. The expandable member is held over the neck to inhibit movement of the embolic material out of the aneurysm. Blood is allowed to flow out of the aneurysm, past the neck of the aneurysm, and through the vessel while the expandable member is held over the neck of the aneurysm.

Sweden–Uruguay relations Sweden–Uruguay relations are foreign relations between Sweden and Uruguay. Sweden has a consulate in Montevideo; the Swedish ambassador in Buenos Aires is concurrent to Uruguay. Uruguay has an embassy in Stockholm, the ambassador being concurrent to Norway, Denmark, Finland, Latvia and Estonia. Sweden was an important refuge for Uruguayan exiles during the civic-military dictatorship (1973-1985); there are several Uruguayans who still live in Sweden. State visits In October 2011, Uruguayan President José Mujica paid an official visit to Sweden. See also Uruguayans in Sweden References External links Uruguay Category:Bilateral relations of Uruguay

form=未知 tags= 美女妖且闲， 采桑歧路间。 柔条纷冉冉， 落叶何翩翩。 攘袖见素手， 皓腕约金环。 头上金爵钗， 腰佩翠琅玕。 明珠交玉体， 珊瑚间木难。 罗衣何飘摇， 轻裾随风还。 顾盼遗光彩， 长啸气若兰。 行徒用息驾， 休者以忘餐。 借问女安居， 乃在城南端。 青楼临大路， 高门结重关。 容华耀朝日， 谁不希令颜？ 媒氏何所营？ 玉帛不时安。 佳人慕高义， 求贤良独难。 众人徒嗷嗷， 安知彼所观？ 盛年处房室， 中夜起长叹。

“I Don’t Care What Weiner Does as Long as He Votes My Way” Everyone’s talking about the Weiner (Carlos Danger) sexting controversy. At the same time people are tepidly condemning “Carlos,” they are praising the put-upon wife, Huma. Many are saying not to judge the couple. We have no right to judge. We don’t know what’s in their hearts. Well folks, if you’re looking for a judgment free zone, you better look elsewhere. How can anyone possibly trust this man with the purse strings and safety of arguably the country’s most prominent and important city? Well, that’s an easy one to answer. The people excusing him and defending his wife, Huma “Rodham” Abedin, are the same liberals that excused and defended Bill and Hillary. They just don’t care, as long as the liberal/progressive agenda is moved forward. Weiner and wife are the embodiment of Bill and Hillary Clinton. They kind of condemned Bill while putting Hillary up on a pedestal. I’d actually like to comment more on Huma rather than the salacious details of the disgusting dog, Carlos. Just look at Huma’s two most important female role models. Her mother, a member of the Muslim Brotherhood and Hillary, a consummate liar and hanger-on. Is Huma practicing Islamic Taqiya, the art of deception when dealing with non-muslims or is she working from Hillary’s victim playbook. Well, it at least appears that Huma is the 21st century Hillary. She is perfectly willing to be a doormat for Carlos Danger. She, like Hillary, appears to have a business relation with her husband. Within reason, Weiner, like Bill, can do whatever he wants as long as Huma is along for the ride. That may all depend on how far he gets. She may give the boot if he loses. But if Weiner is elected Uma had better clear her schedule and be ready to work. Like Hillary, she will spend all her time squashing bimbo eruptions. Like Hillary, Huma “Rodham” Abedin appears to me to be power hungry. She must have visions of power and control, just like her mentor Hillary. Like Hillary, she will be repaid for her husband’s many transgressions. Maybe a New York senator or even Secretary of State? Meanwhile, the female liberal press is fawning over Huma Rodham. These liberal feminist women are defending and actually heralding her as a hero. It’s really quite telling when a so-called feminist will defend her behavior. One would expect them to insist the Huma kick the predator (to a feminist, all men are inherent predators) to the curb. It’s just more proof that liberal feminists are just liberals, not feminist. Just look at whom the liberals hold up as paragons of virtue, of examples of strong women, two door mats like Huma and Hillary. Yet at the same time these very liberals will trash real life strong women such as Sarah Palin or Michelle Bachmann. An honest feminist would embrace the latter and jettison the former. But remember, liberals are liberals first and then whatever else they claim to be second. Also recall that Hillary was never more popular than when she appeared to be trod upon. And she is well aware of how to capitalize on her “victim hood.” Hillary, the Sith Lord, may even be coaching Huma, the apprentice. This is nothing more than politics. Does she love Carlos? Maybe, but who cares. It doesn’t seem to matter to her. This is the penultimate “Ends Justify the Means.” I wonder for women like this; what their breaking point is? I wonder if there is a line they won’t cross?

Hypercholesterolaemia in a group of senior South African Transport Services employees. The lipid profiles of 104 volunteer senior South African Transport Service (SATS) personnel showed that all volunteers had some lipid abnormality, which increased their risk for coronary heart disease. All participants received a single counselling interview with a nursing sister on a lipid-lowering lifestyle. Retesting after 3-4 months of 91 participants revealed that this group had lowered their mean total serum cholesterol value significantly. Twenty-one per cent of the participants had normalised their lipid profiles and the prevalence of hypercholesterolaemia, defined in a number of ways, was reduced, as was the number of possible familial hypercholesterolaemic patients, by 60%. Participants who complied with the dietary recommendations strictly reduced their cholesterol levels significantly, while those who did not were less successful in lowering their serum cholesterol levels. Screening and a single intervention counselling interview improved the coronary risk factor profile of this group of senior SATS personnel.

A serological study on Brucella abortus, caprine arthritis-encephalitis virus and Leptospira in dairy goats in Rio de Janeiro, Brazil. In spite of the large number of goats found in several developing tropical countries, milk production remains unsatisfactory. The occurrence of infectious diseases, such as leptospirosis, brucellosis and caprine arthritis-encephalitis (CAE) may in part be responsible for sub-optimal production. In this study, 1000 serum samples were tested for leptospirosis, 953 for brucellosis and 562 for CAE. All tested flocks presented at least one seroreactive animal for leptospirosis and for CAE. Reactivity to leptospirosis was 11.1%, and serovar hardjo was the most frequently found. Anti-B. abortus agglutinins were found in 0.5% of the samples presented and 14.1% were seroreactive to CAE. Leptospirosis was considered to represent the major infectious problem in the studied goat flocks. The occurrence of infectious diseases in the tested flocks may represent an important factor contributing to the decreased productivity of the animals. These findings may be similar to those observed in other developing countries and require further study to define the relationship between seropositivity and reduced production.

Vaccine industry says that children killed by vaccines don't count (NaturalNews) Question number one: How many kids have died shortly after getting a vaccine, whether the measles, mumps, rubella or even just the flu shot? What is that total statistic? Second question: How many kids have actually died from infectious diseases and influenza who received inoculation for the very disease or sickness from which they died? Third question: Why aren't vaccine-induced deaths part of those statistics, since the kids were injected with the very diseases to which they were supposed to be "100 percent immune?" For more than 50 years, America has succeeded in scaring the "pants off" parents if they don't follow the insane vaccine schedule of 30 or more inoculations for all their babies from birth through six years of age. You could be arrested for not getting the full vaccine schedule now and denied rights to ever see your children again. They're trying to pass laws in Oregon and New York. Check and see. Polio will cripple you! Quick, get some formaldehyde injected into your muscle tissue and you will be safe! The measles are killing entire populations off like some crazy genocidal epidemic, haven't you seen all the deaths at the college campuses? Quick, get some MSG and mercury injected into your blood and make sure all the scary diseases are "deadened" (dormant) when the aluminum crosses your blood-brain barrier. At least when you have Alzheimer's disease when you're older and you don't know who your immediate family is, at least then, you won't have any chicken pox scars! At least when your child is autistic you won't have to worry about him getting the measles or the mumps. Plus, the swine flu almost wiped out the entire world a few years back, so be sure to inject some more human albumin (blood), some GMO chicken embryo, and some aborted fetal cells that have been manipulated in a laboratory by insane scientists who think this is how to build immunity. Vaccine propaganda focuses on measles cases, not deaths from vaccines How many children in the USA have autism right now thanks to vaccines? Do you know? Ten years ago, only one in 10,000 kids had autism in US, now it's one in 68. How many children are harmed or killed by vaccines? Don't those children count when we're talking mortality caused by disease? You inject a disease, die from the injection, and don't count that statistic? Who's in charge of these numbers, the government or the vaccine manufacturers, like Merck? Who gets the government contracts for MMR-2 by faking results and efficacy rates, gets caught, and continues the fraud? In the past 10 years, nobody in the US has died from the measles, but more than 100 people have died from the measles vaccine. Ready to opt out? You can't. Or so they'd have you believe. But you WILL be pressured. You will be herded, like sheep, like cattle, right to the poison well, and you will be terrorized by the CDC and scary pictures of kids who died from the measles. Have you seen the scary pictures of the kids who are deformed by vaccine damage? Oh, those are quite scary. Maybe there's something else you should be frightened of, and it's not infectious disease. Maybe you should be very afraid of toxin manufacturers who are allowed to test their own danger, call it safe, report it in peer reviewed journals, sell it to the CDC, which in turn sells it to America and "distributes it" at your local grocery, pharmacy and elementary schools across the land. Did you know that measles deaths were virtually non-existent prior to the introduction of the vaccine? Check the graphs as reported from CDC and VAERS! Vaccines are just a shot in the dark! The Nazis under Hitler believed that there was a master race, that had better genes (DNA) and better immunity than all other living things on earth. The Nazi scientists created dangerous drugs to experiment on humans, the ones they called inferior and a blight to society. The Nazis experimented on living beings like they were guinea pigs in cages, and they did not care how much they suffered all the while. There were no statistics kept on file of which Jews died, how they died, when they died, and their families were not notified of their death. Jews were injected with chemicals, and gassed with chemicals and children were stolen from their parents and abused, tortured and eventually sold off or killed. Does that sound familiar? Today, in the USA, if parents try to get a second opinion after an allopathic doctor tells them they must have vaccines, surgery, chemotherapy and radiation, those children are taken away from them by CPS, child protective services (doing ironically the opposite of their name) and putting the children in abusive foster homes or just trafficking them on the black market. Should those statistics be added into the vaccine and medicine damaged statistic for all to see? http://www.naturalnews.com Vaccines contain so many toxins we are told never to eat or put on our skin. If you break a thermometer, beware of the mercury! But injecting it into muscle tissue builds antibodies so you won't get polio, even though the polio vaccine contains cancer. Oops. It's all just a shot in the dark -- this allopathic nightmare of chemical medicine. Don't be a guinea pig for Nazi-Med-Amerika. Don't be bullied into vaccines. You won't just be a statistic, you'll be a statistic that's not even counted.

Scripta Scripta may stand for: Jussi Halla-aho's Finnish-language blog Scripta The owner of Hungarian-language Romanian newspaper Új Magyar Szó Other Scriptas: Scripta continua aka word divider Scripta Mathematica, quarterly journal published by Yeshiva University devoted to the philosophy, history, and expository treatment of mathematics

MW Motorsport MW Motorsport (formerly known as Matthew White Racing) is a motor-racing team that is competing in the Dunlop Super2 Series. The team curently races with Nissan Altimas, with Zak Best, Jayden Ojeda and Thomas Randle. The team was formed by Matthew White in 2000 to further his own racing ambitions. Originally Matthew White Racing was a privateer V8 Supercar, specifically supporting White's career, but he took on a customer driver for the first time in 2002 and the team gradually changed over the next five years into a professional pay driver operation in the Fujitsu V8 Supercar Series. The team made infrequent appearances at V8 Supercar endurance races. The team was granted a wildcard entry for the 2009 L&H 500 and 2009 Supercheap Auto Bathurst 1000. Brad Lowe and Damian Assaillit drove the car to only modest results. The teams greatest success was in the 2009 Fujitsu V8 Supercar Series when Jonathon Webb won the series winning all but one race in the second half of the season. For 2017, the team will switch to Nissan and run a pair of Nissan Altima Supercars, although Bryce Fullwood will campaign an older generation Ford FG Falcon up until the Townsville round, where he is expected to upgrade to the COTF Nissan Altima. They will then become the first non-Holden or Ford Team in the series. Drivers References External links Category:Supercars Championship teams Category:Australian auto racing teams Category:Sports teams in Victoria (Australia)

Identification and molecular characterization of an N-acetylmuramyl-L-alanine amidase Sle1 involved in cell separation of Staphylococcus aureus. We purified a peptidoglycan hydrolase involved in cell separation from a Staphylococcus aureus atl null mutant and identified its gene. Characterization of the gene product shows a 32 kDa N-acetylmuramyl-L-alanine amidase that we designated Sle1. Analysis of peptidoglycan digests showed Sle1 preferentially cleaved N-acetylmuramyl-L-Ala bonds in dimeric cross-bridges that interlink the two murein strands in the peptidoglycan. An insertion mutation of sle1 impaired cell separation and induced S. aureus to form clusters suggesting Sle1 is involved in cell separation of S. aureus. The Sle1 mutant revealed a significant decrease in pathogenesis using an acute infection mouse model. Atl is the major autolysin of S. aureus, which has been implicated in cell separation of S. aureus. Generation of an atl/sle1 double mutant revealed that the mutant cell separation was heavily impaired suggesting that S. aureus uses two peptidoglycan hydrolases, Atl and Sle1, for cell separation. Unlike Atl, Sle1 is not directly involved in autolysis of S. aureus.

The present invention relates to a mushroom-shaped semiconductor stripe laser. More particularly, the present invention relates to a mushroom-shaped semiconductor stripe laser, particularly with transversal, monomode light distribution, including a semiconductor double heterostructure comprised of a substrate, a laser-active zone, and a cover layer, as well as a respective electrically contacting metal layer for the substrate and for the cover layer, and with the cover layer being underetched such that a mushroom-shaped structure is formed in which the laser-active zone is constricted to a stripe-shaped region. Such a semiconductor laser is also called an MS laser ("mushroom stripe laser") and is disclosed, for example, in the publication Japanese Journal of Applied Physics, Volume 22, Nov. 1983, pages L721-L723. As shown in FIG. 1, which is a schematic illustration of the cross-section of such a known MS laser, a semiconductor substrate 1 has initially applied to it a further substrate layer 1' (buffer layer). On top of the outer major surface of layer 1' is a stripe-shaped laser-active zone 2, which has a first width b1 of approximately 1.5 micron, a height of approximately 0.1 micron and a length (perpendicularly to the plane of the drawing) of, for example, 150 microns. The laser-active zone 2 is covered over its entire length by a cover layer 3 which has a height of approximately 1.5 micron and a second width b2 of approximately 15 microns. Laser-active zone 2 as well as cover layer 3 therefore form a mushroom-shaped semiconductor structure which can be produced by an etching technique customarily employed in the semiconductor art (underetching of cover layer 3). This mushroom-shaped semiconductor structure is embedded in an oxide layer 4. This embedding in an oxide layer may cause cavities 5 to be formed in the oxide layer 4 below the cover layer 3. In the region of oxide layer 4 on the outer surface of the cover layer 3, a contact window 6 is provided so that it is possible to electrically contact cover layer 3 by way of a metal layer 7. A further such metal layer 7' is also provided on the underside or opposite major surface of substrate 1. The described arrangement is a laser diode with lateral wave guidance known as an index guided laser. The described arrangement has the drawback that the ratio of the second width b2 to the first width b1 is very large (approximately 10). This produces, particularly for industrial mass production, an uneconomical proportion of unusable semiconductor lasers. For example, the mechanical stresses produced between the oxide layer 4 and the cover layer 3 are so great that they bring about undesirable separation of the cover layer 3 from the laser-active zone 2. Moreover, during the above-mentioned underetching of the cover layer 3, undesirable fluctuations occur in the first width b1. This makes it impossible, in particular, to always guarantee that monomode light distribution is assured in the finished semiconductor laser.

Wanve M, Kaur H, Sarmah D, et al. Therapeutic spectrum of interferon‐β in ischemic stroke. J Neuro Res. 2019;97:116--127. 10.1002/jnr.24333 **Funding Information** Science and Engineering Research Board, Grant/Award Number: SB/YS/LS‐196/2014; NIPER‐Ahmedabad; Department of Pharmaceuticals, Ministry of Chemical and Fertilizers; International Society for Neurochemistry 1. STROKE {#jnr24333-sec-0001} ========= Stroke is a global health concern that leads to permanent disability in approximately 30% of survivors (Weinstein, Koerner, & Möller, [2010](#jnr24333-bib-0079){ref-type="ref"}). It has devastating complications arising from either a sudden loss of blood supply to the brain (ischemic stroke) or rupturing of blood vessels in the brain (hemorrhagic stroke) (Deb, Sharma, & Hassan, [2010](#jnr24333-bib-0016){ref-type="ref"}). Stroke leads to the induction of inflammatory cascade via migration of activated microglia to the ischemic core, worsening its outcomes (Perera et al., [2006](#jnr24333-bib-0063){ref-type="ref"}). The narrow therapeutic window and insufficiency to recover or protect the dying neurons are certain limitations of current treatment strategies for stroke, so there is an urgent need for an alternative approach (Fann et al., [2013](#jnr24333-bib-0021){ref-type="ref"}; Kaur et al., [2018](#jnr24333-bib-0042){ref-type="ref"}). The limitation to improve the aggravated inflammatory condition by currently used thrombolytic agents necessitates newer treatment options for stroke (Carroll, [2009](#jnr24333-bib-0011){ref-type="ref"}). Interferon‐β is known to have immunomodulatory and anti‐inflammatory properties and can be explored for improving conditions after stroke (Dhib‐Jalbut & Marks, [2010](#jnr24333-bib-0018){ref-type="ref"}). IFN‐β plays a role as an anti‐inflammatory agent through several immune cascades. IFN‐β significantly helps in obviating neuro‐inflammatory conditions of the central nervous system and improves the pathogenesis of many neurological conditions. A report suggested its role in decreasing neuronal cell death and increasing functional recovery attenuating inflammation after stroke onset (Kuo et al., [2016](#jnr24333-bib-0051){ref-type="ref"}). 2. INTERFERON {#jnr24333-sec-0002} ============= Interferons (IFNs) are signaling proteins belonging to a family of cytokines (Nallar & Kalvakolanu, [2014](#jnr24333-bib-0062){ref-type="ref"}). IFNs are actively engaged in altering the cellular immune system against the viral infections of host cells (Fritsch & Weichhart, [2016](#jnr24333-bib-0025){ref-type="ref"}). IFNs generally act against extracellular biomolecules via the stimulation of Toll‐like receptors (TLRs) and amplify the antigen presentation to specific T cells. They act by both paracrine and autocrine modes for the regulation of acquired and innate immunity via stimulation of intercellular and intracellular networks providing resistance to certain viral infections and maintenance of normal cell survival and tumor cell death (Le, Genin, Baines, & Hiscott, [2000](#jnr24333-bib-0053){ref-type="ref"}). 2.1. Types of interferons and their signaling pathways {#jnr24333-sec-0003} ------------------------------------------------------ Interferons have been classified according to their structural homology and receptor types as type I, II, and III. Type I IFNs include alpha (α), beta (β), delta (δ), epsilon (Ɛ), kappa (κ), and omega (ω). Type‐II IFNs include gamma (γ) and type‐III, also known as IFN‐lambda (λ), have interferon‐like activities (Kopitar‐Jerala, [2017](#jnr24333-bib-0046){ref-type="ref"}; Wack, Terczyńska‐Dyla, & Hartmann, [2015](#jnr24333-bib-0076){ref-type="ref"}). Type‐I IFNs α and β act by binding to interferon alpha‐receptors (IFNARs). The IFNAR is a heterodimeric transmembrane receptor consisting of two subunits that is, IFNAR1 and IFNAR2 (Sheppard et al., [2003](#jnr24333-bib-0069){ref-type="ref"}). The binding of IFNs α and β with the IFNAR leads to the activation of receptor‐associated protein tyrosine kinases. Janus kinase 1 and tyrosine kinase 2 in turn phosphorylate the signal transducer and activator of transcription 1 (STAT1) and 2 (STAT2). Activation of STAT 1 and 2 is followed by dimerization and translocation into the nucleus and, by combining with IFN‐regulatory factor 9, forms a trimolecular complex called IFN‐stimulated gene factor 3 (ISGF3). This ISGF3 further binds to DNA sequences, which are known as IFN‐stimulated response elements, and directly activates the transcription of ISGs. The signal decays within a period of hours and the STATs are exported back to the cytoplasm for the next signaling process (Figure [1](#jnr24333-fig-0001){ref-type="fig"}). Other key regulators of the IFN signaling cascade are the negative regulators which cover different mechanisms that suppress type I IFN‐mediated expressions such as suppressor of cytokines signaling (SOCS) and ubiquitin carboxy‐terminal hydrolase 18 (USP 18) (Kopitar‐Jerala, [2017](#jnr24333-bib-0046){ref-type="ref"}; Schreiber & Piehler, [2015](#jnr24333-bib-0068){ref-type="ref"}) (Table [1](#jnr24333-tbl-0001){ref-type="table"}). ![Interferon signaling pathway. Binding of IFNs (α and β) with IFNAR (Interferon‐α/β receptor): Activation of receptor‐associated protein tyrosine kinase. (a) Janus kinase‐1. (b) Tyrosine kinase‐2. (c) Signaling pathway through TRIF. These two protein tyrosine kinases start phosphorylation of signal transducer and activator of transcription1 STAT1 & STAT2. Activation of STAT1 & STAT2. Dimerization and translocation of STAT1 & STAT2 to the nucleus. Formation of trimolecular complex together with IFN‐regulatory factor‐9 (IRF‐9) that is, IFN‐stimulated gene factor‐3 (ISGF3). Binding of ISGF‐3 with DNA sequence called as IFN‐stimulated response elements. These IFN‐stimulated response elements activate transcription of ISGs directly and regulate signaling of IFNs. Within hours signal decays and STATs return to cytoplasm for next signaling pathway. TLR 4 mediated IFN‐β activation through TRIF‐dependent pathway via Interferon regulatory factor 3 (IRF‐3) \[Colour figure can be viewed at <http://wileyonlinelibrary.com>\]](JNR-97-116-g001){#jnr24333-fig-0001} ###### Types of human IFN and IFN‐like proteins Ligand types Names Receptor chain 1 Receptor chain 2 ------------------- -------- ------------------ ------------------ IFN (Type‐I) IFN‐α IFN‐α R1/IFNAR1 IFN‐α R2/IFNAR2 IFN‐β IFN‐k IFN‐ε IFN‐ω IFN‐v IFN (Type‐II) IFN‐γ IFN‐γ R1 IFN‐γ R2 IFN‐like proteins IL‐28A IL‐28R1 IL‐10R2 IL‐28B IL‐29 John Wiley & Sons, Ltd This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency. ### 2.1.1. Role of interferons {#jnr24333-sec-0004} Type I IFNs (IFN‐α and IFN‐β) exhibit a wide breadth of biological activities (antiviral, anti‐inflammatory, and anti‐proliferative) (Kuo et al., [2016](#jnr24333-bib-0051){ref-type="ref"}). The latter occurs via cytotoxic stimulation of numerous cells of the immune system such as natural killer cells, monocytes, T cells, macrophages, and dendritic cells. IFNs can also upregulate the cell surface expression of major histocompatibility complex (MHC) antigens and tumor‐associated surface antigens. It helps in the induction or activation of pro‐apoptotic genes and proteins (Bak, Bax, TNF‐related apoptosis‐inducing ligand (TRAIL), and caspases) as well as the repression or reduction of anti‐apoptotic genes such as inhibitor of apoptosis protein (IAP) and B‐cell lymphoma 2 (Bcl‐2), responsible for cell proliferation and differentiation and anti‐angiogenic activity (Pestka, [2007](#jnr24333-bib-0064){ref-type="ref"}). IFNs have been recognized to be deeply implicated in the pathogenesis of several diseases, for example, collagen diseases such as rheumatoid arthritis (Conigliaro et al., [2010](#jnr24333-bib-0013){ref-type="ref"}), systemic lupus erythematosus (SLE) (Gao, Anolik, & Looney, [2018](#jnr24333-bib-0026){ref-type="ref"}), multiple sclerosis (Rudick & Goelz, [2011](#jnr24333-bib-0066){ref-type="ref"}), insulin‐dependent diabetes mellitus (Qaisar, Jurczyk, & Wang, [2018](#jnr24333-bib-0065){ref-type="ref"}), pancreatic cancer (Booy, Hofland, & van Eijck, [2015](#jnr24333-bib-0009){ref-type="ref"}), fulminant hepatitis (Borst et al., [2018](#jnr24333-bib-0010){ref-type="ref"}), atherosclerosis (Moss & Ramji, [2017](#jnr24333-bib-0061){ref-type="ref"}), and allergic diseases (Gonzales‐van Horn & Farrar, [2015](#jnr24333-bib-0031){ref-type="ref"}). IFNs are clinically used in the therapy against viral infections such as hepatitis B and C (Asselah & Marcellin, [2018](#jnr24333-bib-0004){ref-type="ref"}; Jaeckel et al., [2001](#jnr24333-bib-0038){ref-type="ref"}) and for different malignancies (Baron et al., [1991](#jnr24333-bib-0007){ref-type="ref"}; Imanishi, [1994](#jnr24333-bib-0036){ref-type="ref"}). #### Interferon‐β {#jnr24333-sec-0005} Interferon‐β (IFN‐β), a broadly expressed cytokine, was approved by the US FDA in the past for the relapsing‐remitting multiple sclerosis (RRMS) treatment for more than a decade (Kuo et al., [2016](#jnr24333-bib-0051){ref-type="ref"}). IFN‐β drives innate immunity, acting in response to pathogenic attack or injury via activation of both pro‐and anti‐inflammatory cytokines. Currently, research is being conducted to find a protective role of IFN‐β in several diseases such as ischemic stroke, subarachnoid hemorrhage, colitis, colorectal cancer (Kotredes, Thomas, & Gamero, [2017](#jnr24333-bib-0047){ref-type="ref"}; Kuo et al., [2016](#jnr24333-bib-0051){ref-type="ref"}; Tiebosch et al., [2013](#jnr24333-bib-0074){ref-type="ref"}) along with other conditions (Table [2](#jnr24333-tbl-0002){ref-type="table"}) (68), such as anti‐inflammatory (Kuo et al., [2016](#jnr24333-bib-0051){ref-type="ref"}), antiviral (Kraus & Oschmann, [2006](#jnr24333-bib-0048){ref-type="ref"}; Samuel, [2001](#jnr24333-bib-0067){ref-type="ref"}), immuno modulatory (Kasper & Reder, [2014](#jnr24333-bib-0041){ref-type="ref"}), anti‐proliferative (Dierckx et al., [2017](#jnr24333-bib-0019){ref-type="ref"}), anti‐angiogenic (Friedman, [2008](#jnr24333-bib-0024){ref-type="ref"}), and cell differentiation (Kraus & Oschmann, [2006](#jnr24333-bib-0048){ref-type="ref"}) (see Table [2](#jnr24333-tbl-0002){ref-type="table"}). ###### Clinical trials of interferon beta‐1b and interferon beta‐1a Sr. No Phase Status Condition Count References ------------------ ------------- ----------------------- ---------------------------------------------------------------------------------- ------- ---------------------------- Interferon‐β *Interferon‐β1b* 1\. I Completed Disseminated Sclerosis I <https://www.drugbank.ca/> 2\. I Completed Human Immuno‐deficiency Virus Infections (HIV)/Kaposis Sarcoma I <https://www.drugbank.ca/> 3\. I, II Completed Acute Respiratory Distress Syndrome (ARDS)/Acute Lung Injury (ALI) I <https://www.drugbank.ca/> 4\. II Completed Disseminated Sclerosis III <https://www.drugbank.ca/> 5\. II Completed Disseminated Sclerosis/Relapsing‐Remitting Multiple Sclerosis (RRMS) I <https://www.drugbank.ca/> 6\. II Completed Heart Disease/Prophylaxis of Cardiomyopathy I <https://www.drugbank.ca/> 7\. II Completed Relapsing‐Remitting Multiple Sclerosis (RRMS) I <https://www.drugbank.ca/> 8\. II Completed Disseminated Sclerosis I <https://www.drugbank.ca/> 9\. II, III Not known Disseminated Sclerosis/Relapsing‐Remitting Multiple Sclerosis (RRMS) I <https://www.drugbank.ca/> 10\. II, III Recruiting Middle East Respiratory Syndrome Coronavirus (MERS‐Coronavirus) I <https://www.drugbank.ca/> 11\. II, III Recruiting Disseminated Sclerosis I <https://www.drugbank.ca/> 12\. III Terminated Disseminated Sclerosis II <https://www.drugbank.ca/> 13\. III Completed Human Immunodeficiency Virus Infections I <https://www.drugbank.ca/> 14\. III Completed Relapsing‐Remitting Multiple Sclerosis (RRMS II <https://www.drugbank.ca/> 15\. III Completed Relapsing‐Remitting Multiple Sclerosis (RRMS) I <https://www.drugbank.ca/> 16\. III Terminated Disseminated Sclerosis I <https://www.drugbank.ca/> 17\. IV Withdrawn Disseminated Sclerosis I <https://www.drugbank.ca/> 18\. IV Completed Relapsing‐Remitting Multiple Sclerosis (RRMS) IV <https://www.drugbank.ca/> 19\. IV Completed Relapsing‐Remitting Multiple Sclerosis (RRMS) I <https://www.drugbank.ca/> 20\. IV Terminated Relapsing‐Remitting Multiple Sclerosis (RRMS) I <https://www.drugbank.ca/> *Interferon‐β1a* 1\. 0 Completed Disseminated Sclerosis I <https://www.drugbank.ca/> 2\. I Completed Healthy volunteers II <https://www.drugbank.ca/> 3\. I Completed Cerebrovascular Accidents I <https://www.drugbank.ca/> 4\. I Completed Disseminated Sclerosis I <https://www.drugbank.ca/> 5\. I Completed Relapsing‐Remitting Multiple Sclerosis (RRMS) II <https://www.drugbank.ca/> 6\. II Completed Disseminated Sclerosis V <https://www.drugbank.ca/> 7\. II Completed Asthma Bronchial I <https://www.drugbank.ca/> 8\. II Completed Alzheimer\'s Disease (AD) I <https://www.drugbank.ca/> 9\. II Completed Polyradiculoneuropathy, Chronic Inflammatory Demyelinating I <https://www.drugbank.ca/> 10\. II Completed Relapsing‐Remitting Multiple Sclerosis (RRMS) III <https://www.drugbank.ca/> 11\. II Completed Ulcerative Colitis (UC) II <https://www.drugbank.ca/> 12\. II Terminated Crohn's Disease (CD) I <https://www.drugbank.ca/> 13\. II Withdrawn Relapsing‐Remitting Multiple Sclerosis (RRMS) I <https://www.drugbank.ca/> 14\. II, III Active Not Recruiting Disseminated Sclerosis I <https://www.drugbank.ca/> 15\. II, III Recruiting Disseminated Sclerosis/Relapsing‐Remitting Multiple Sclerosis (RRMS) I <https://www.drugbank.ca/> 16\. III Completed Disseminated Sclerosis III <https://www.drugbank.ca/> 17\. III Completed Chronic Hepatitis‐C Infection I <https://www.drugbank.ca/> 18\. III Completed Clinically Isolated Syndrome (CIS) I <https://www.drugbank.ca/> 19\. III Recruiting Respiratory Distress Syndrome, Adult I <https://www.drugbank.ca/> 20\. III Terminated Relapsing‐Remitting Multiple Sclerosis (RRMS) I <https://www.drugbank.ca/> 21\. III Terminated Disseminated Sclerosis I <https://www.drugbank.ca/> 22\. III Withdrawn Relapsing‐Remitting Multiple Sclerosis (RRMS) I <https://www.drugbank.ca/> 23\. IV Completed Disseminated Sclerosis V <https://www.drugbank.ca/> 24\. IV Completed Relapsing‐Remitting Multiple Sclerosis (RRMS) XII <https://www.drugbank.ca/> 25\. IV Completed Clinically Isolated Syndrome (CIS)/Relapsing‐Remitting Multiple Sclerosis (RRMS) I <https://www.drugbank.ca/> 26\. IV Terminated Relapsing‐Remitting Multiple Sclerosis (RRMS) I <https://www.drugbank.ca/> 27\. IV Terminated Disseminated Sclerosis I <https://www.drugbank.ca/> 28\. IV Withdrawn Demyelinating Disorders/Disseminated Sclerosis/Neuritis/Optic Neuritis I <https://www.drugbank.ca/> 29\. IV Withdrawn Relapsing‐Remitting Multiple Sclerosis (RRMS) II <https://www.drugbank.ca/> 30\. Unavailable Withdrawn Disseminated Sclerosis I <https://www.drugbank.ca/> John Wiley & Sons, Ltd This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency. 2.2. Interferon‐beta (IFN‐β): Mechanistic roles and actions {#jnr24333-sec-0006} ----------------------------------------------------------- Neurodegeneration is mostly triggered by numerous inflammatory mediators that can lead to neurological pathologies including ischemic stroke (Zipp & Aktas, [2006](#jnr24333-bib-0084){ref-type="ref"}). Inflammation is initiated by the release of various inflammatory mediators; activation of intravascular leukocytes helps in the infiltration of immune cells in the CNS (Anrather & Iadecola, [2016](#jnr24333-bib-0002){ref-type="ref"}; Kieseier, [2011](#jnr24333-bib-0044){ref-type="ref"}). Immune cells migration across the blood--brain barrier (BBB) causes breakdown of the BBB due to the release of numerous cytotoxic agents like cytokines, matrix metalloproteinase, nitric oxide (NO), and reactive oxygen species (ROS), leading to demyelination and axonal injury which are common outcomes of neurodegeneration (Kuo et al., [2016](#jnr24333-bib-0051){ref-type="ref"}). Although the damage caused to neurons is not reparable, immunomodulatory therapies have been reported to decrease inflammation (Markowitz, [2007](#jnr24333-bib-0056){ref-type="ref"}). IFN‐β, a polypeptide produced by fibroblasts, attaches to its specific receptor and initiates a complex transcriptional reaction producing a pharmacological response at the site of injury. Markowitz reported that IFN‐β helps in suppressing antigen presentation, decreasing T cell proliferation, and altering cytokine and matrix metalloproteinase expression (Kieseier, [2011](#jnr24333-bib-0044){ref-type="ref"}; Markowitz, [2007](#jnr24333-bib-0056){ref-type="ref"}). IFN‐β helps in the elevation of concentration and expression of anti‐inflammatory agents while it down‐regulates the pro‐inflammatory cytokine expression (Kuo et al., [2016](#jnr24333-bib-0051){ref-type="ref"}). A systemic application of IFN‐β may reduce the increased cell count of inflammatory cells across the BBB and help raise nerve growth factor (NGF) levels, ultimately resulting in a dramatic increase in the survival of neurons (Kieseier, [2011](#jnr24333-bib-0044){ref-type="ref"}). IFN‐β may also help in raising the CD56^bright^ natural killer cell count: these cells produce anti‐inflammatory mediators very efficiently and have the capacity to mitigate neuronal inflammation in the peripheral blood circulation. With various mechanistic approaches, IFN‐β manifests to be clinically relevant by reducing lesions, decreasing the risk of sustained disability progression, and decreasing brain atrophy (Kieseier, [2011](#jnr24333-bib-0044){ref-type="ref"}). Cerebral ischemia is responsible for producing various immune cell mediators which can exacerbate ischemic brain injury. These various inflammatory mediators, under certain situations, may induce tolerance to cerebral ischemia. Mediators like proinflammatory cytokines for example, interleukin 1 (IL‐1), tumor necrosis factor (TNF), and damage‐associated molecular patterns (DAMPs) are responsible for the activation of intracellular signaling pathways which mediate stress responses (Anrather & Iadecola, [2016](#jnr24333-bib-0002){ref-type="ref"}). Immune cell therapies are highly explored in not only preclinical but also clinical settings for various acute injuries related with the CNS, including stroke (Bang, [2016](#jnr24333-bib-0006){ref-type="ref"}; George & Steinberg, [2015](#jnr24333-bib-0029){ref-type="ref"}). IFN‐β is immunomodulatory and helps regulate the function of immune cells in ischemic stroke. IFN‐β modulates antigen presenting cells (APCs) to reduce antigen presentation and stimulation of T cells (Jiang et al., [1995](#jnr24333-bib-0039){ref-type="ref"}). IFN‐β directly affects T cells and inhibits adhesion of molecules like intercellular adhesion molecule (ICAM) and vascular adhesion molecule (VCAM) to the BBB and passage through the same (Dhib‐Jalbut & Marks, [2010](#jnr24333-bib-0018){ref-type="ref"}). B cells secrete inflammatory mediators that are responsible for stimulating plasma cells to produce immunoglobulins (IGs) in the cerebrospinal fluid (CSF) (Dalakas, [2008](#jnr24333-bib-0015){ref-type="ref"}). B cell activating factor (BAFF), belonging to the TNF family, is upregulated in the blood (Krumbholz et al., [2008](#jnr24333-bib-0049){ref-type="ref"}) and is crucial for maintaining B cells level at the inflammation site and can aggravate local inflammation by facilitating B cell survival (Krumbholz et al., [2005](#jnr24333-bib-0050){ref-type="ref"}). IFN‐β modulates B‐cell function which can alter antigen presentation. Expression of MHC II on B cells is reduced post‐therapy with the help of IFN‐β through a decrease in CD80 expression that inhibits antigen presentation to CD8+T cells (Genç, Dona, & Reder, [1997](#jnr24333-bib-0028){ref-type="ref"}; Jiang et al., [1995](#jnr24333-bib-0039){ref-type="ref"}). IFN‐β treatment results in the upregulation of CD86 expressing B cells and contributes to the reduction of type 1 T helper (Th1) cell secretion of inflammatory cytokines (Huang, Ito, Dangond, & Dhib‐Jalbut, [2013](#jnr24333-bib-0035){ref-type="ref"}). Levels of BAFF are also upregulated in blood leukocytes and serum with IFN‐β therapy, showing elevated B cell function (Krumbholz et al., [2008](#jnr24333-bib-0049){ref-type="ref"}). With the correct combination of stimuli, it can lead to increased B cell secretion of anti‐inflammatory cytokines like IL‐8 and IL‐10, suggesting that IFN‐β can increase CD4 and CD8 regulatory T cells along with regulatory B cells (Meinl, Krumbholz, & Hohlfeld, [2006](#jnr24333-bib-0059){ref-type="ref"}). 3. ISCHEMIC STROKE AND INTERFERON‐β: CROSSTALK {#jnr24333-sec-0007} ============================================== 3.1. Ischemic cascade {#jnr24333-sec-0008} --------------------- Cell death following brain ischemia is mediated by a diverse group of etiologies such as severe focal hypoperfusion that eventually results into excitotoxicity and oxidative damage (Lakhan, Kirchgessner, & Hofer, [2009](#jnr24333-bib-0052){ref-type="ref"}). These events are responsible for causing microvascular injury, BBB dysfunction, and elicit inflammation after ischemia. Events of such kind worsen the primary injury and may result in severe cerebral damage. The extent of permanent cerebral damage relies upon different factors such as ischemic duration, infarct volume, along with the auto‐repairing capability of the brain (Dirnagl, Iadecola, & Moskowitz, [1999](#jnr24333-bib-0020){ref-type="ref"}; Lakhan et al., [2009](#jnr24333-bib-0052){ref-type="ref"}). The responses after inflammatory cascade that worsen the cerebral injury post‐ischemia is an interesting target for therapeutics, as inflammation increases over time and is strongly involved in the exacerbation of neuronal outcomes (Jin, Yang, & Li, [2010](#jnr24333-bib-0040){ref-type="ref"}). It has been reported that post‐ischemia, systemically applied IFN‐β helps in attenuating brain infarct progression (Veldhuis et al., [2003](#jnr24333-bib-0075){ref-type="ref"}). During the sub‐acute phase of ischemia, resident microglial cells (MGs) and peripheral inflammatory cells infiltrate into the surrounding and core region of the infarct area of the brain, leading to secondary neurodegeneration (Weinstein et al., [2010](#jnr24333-bib-0079){ref-type="ref"}). The onset of ischemia is mainly linked with the extravasation of plasma‐derived protein, bioactive phospholipids, BBB disruption, and prompt resident MG activation and infiltration into the ischemic site. These multifarious events lead to the activation of pro‐inflammatory cytokines like chemokines (C‐C motif) ligand 2 (CCL2), chemokine (C‐C motif) ligand 3 (CCL3), TNF‐α, IL‐1b, and endogenous NO release at the injury site, culminating in neuronal death (Denes, Thornton, Rothwell, & Allan, [2010](#jnr24333-bib-0017){ref-type="ref"}; Weinstein et al., [2010](#jnr24333-bib-0079){ref-type="ref"}). 3.2. Neuroprotective role of IFN‐β in Ischemic stroke {#jnr24333-sec-0009} ----------------------------------------------------- CNS inflammation induced due to ischemic conditions plays an essential role in stroke pathophysiology and exacerbates infarct formation at the injury site (Amantea et al., [2015](#jnr24333-bib-0001){ref-type="ref"}; Benakis, Garcia‐Bonilla, Iadecola, & Anrather, [2015](#jnr24333-bib-0008){ref-type="ref"}; Kawabori & Yenari, [2015](#jnr24333-bib-0043){ref-type="ref"}). IFN‐β markedly reduces infarct size by inhibition of the production of inflammatory cytokines such as IL‐6, IL‐23p19, IL‐1b, and TNF‐α; all of these cytokines are found to be increased in the ipsilateral part of the ischemic brain (Kuo et al., [2016](#jnr24333-bib-0051){ref-type="ref"}) (Figure [2](#jnr24333-fig-0002){ref-type="fig"}). Endogenous IFN‐β signaling limits local inflammation, regulates peripheral immune cells, and, thereby, may contribute positively to stroke outcome (Inácio et al., [2015](#jnr24333-bib-0037){ref-type="ref"}). ![Mechanism of action of IFN‐β. (a) After ischemic injury, immune cells like mast cells, macrophages, and neutrophils from the circulation release the inflammatory cytokines. These inflammatory cytokines include IL‐6, IL‐4, IL‐1B, IL‐23p9, and TNF‐α. At ischemic injury site, there is over‐expression of these inflammatory cytokines. These overexpressed inflammatory cytokines lead to CNS inflammation. Increased CNS inflammation results in infarct formation in the brain. IFN‐β helps in suppressing overexpressed inflammatory cytokines and ultimately helps in reducing the brain infarct in ischemic brain. (b) After an ischemic injury on the ipsilateral side of the hemisphere, there are increased expressions of IBA1 (specifically expressed in microglial cells (MGs), helps in MG regulation) in the cortex. Increased IBA1 results in the transformation of resting MGs to reactive MGs. Reactive MGs influence release of inflammatory cytokines, for example, IL‐6, IL‐4, IL‐1B, IL‐23p9, and TNF‐α leads to cytotoxicity which in turn results in infarct formation in the brain at the injury site. IFN‐β inhibits upregulated IBA1 expression in the cortex of ipsilateral side and reduces the MG activation in the ischemic brain \[Colour figure can be viewed at <http://wileyonlinelibrary.com>\]](JNR-97-116-g002){#jnr24333-fig-0002} Rapidly activated MGs in response to ischemic injury are a major factor for the production of inflammatory mediators and increased phagocytosis. Activated MGs trigger innate immune responses followed by increased production of matrix metalloproteinase (MMPs), leading to BBB damage. These inflammatory mediators cause various cytotoxic effects due to the increased expression of inflammatory cytokines at the ischemic site (Benakis et al., [2015](#jnr24333-bib-0008){ref-type="ref"}; Xia, Han, Huang, & Ying, [2010](#jnr24333-bib-0081){ref-type="ref"}). Recent findings report that during cerebral ischemia, activated MGs exhibit a high level of ionized calcium‐binding adapter molecule 1 (IBA1) expression, confirmed by confocal images showing round and amoeboid shaped morphology with very short processes and bigger soma in the cortex of the ipsilateral hemisphere (Kuo et al., [2016](#jnr24333-bib-0051){ref-type="ref"}). IFN‐β treatment helps in the suppression of lBA1 expression by reducing MG activation at the site of injury, there by showing ramified morphology with longitudinally branched and smaller soma. Kuo et al. found that IFN‐β's inhibitory effect on activation of MG is due to a reduction in the expression of pro‐inflammatory cytokines interleukin 23p19 (IL‐23p19), IL‐1b, IL‐6, and TNF‐α at the site of infarct (Kuo et al., [2016](#jnr24333-bib-0051){ref-type="ref"}) (Figure [2](#jnr24333-fig-0002){ref-type="fig"}). A study carried out by Cruz et al. reported that IFN‐β requires IFN regulatory factor 2 binding protein 2 (IRF2BP2) to limit ischemic stroke injury. Mice lacking IRF2BP2‐deficient microglia/macrophages lost the anti‐inflammatory property of IFN‐β, which failed to protect them from ischemic injuries (Cruz et al., [2017](#jnr24333-bib-0014){ref-type="ref"}). Recent work has identified that TLRs and type 1 IFN signaling mediate neuroprotection in both ischemia/reperfusion and ischemic preconditioning (IPC) (McDonough et al., [2017](#jnr24333-bib-0057){ref-type="ref"}). It has been reported that in a mouse model of ischemic injury type 1, IFN signaling is essential for IPC‐directed neuroprotection in white matter (Hamner et al., [2015](#jnr24333-bib-0032){ref-type="ref"}) and gray matter (Stevens et al., [2011](#jnr24333-bib-0072){ref-type="ref"}). McDonough et al. proposed that during ischemia/reperfusion injury MGs lead to the activation of endogenous neuroprotection pathways which are dependent on the IFN‐stimulated genes (ISGs) response (McDonough & Weinstein, [2016](#jnr24333-bib-0058){ref-type="ref"}). Wang et al. ([2017](#jnr24333-bib-0077){ref-type="ref"}) reported that by promoting expression of TIR‐domain containing adapter‐inducing interferon‐β (TRIF) with the compound Dexmedetomidine improved stroke recovery, supporting the beneficial effect of interferon‐beta in ischemic stroke (Wang et al., [2017](#jnr24333-bib-0077){ref-type="ref"}). Experimental preconditioning models are robust and primarily focus on neuroprotective actions (Gesuete et al., [2012](#jnr24333-bib-0030){ref-type="ref"}). Gesuete et al., uncovered the protective preconditioning effect of polyinosinic polycytidylic acid (poly‐ICLC) against cerebral ischemic injury. They found that treatment with poly‐ICLC in in vitro and in vivo ischemia models induced IFN‐β mRNA expression and type I IFN signaling in brain microvascular endothelial cells, which attenuated BBB dysfunction and was required for neuroprotection against ischemic injury (Gesuete et al., [2012](#jnr24333-bib-0030){ref-type="ref"}). During ischemic injury, chemokine induction enhances the peripheral immune cell recruitment to the ischemic brain. Chemokines, including monocyte chemoattractant protein‐1 (MCP‐1), macrophage inflammatory protein‐1α (MIP‐1α), CCL2, and CCL3 are essential in the recruitment of monocytes/macrophage, while Chemokine (C‐X‐C motif) ligand 3 (CXCL3) is essential for neutrophil recruitment (Kuo et al., [2016](#jnr24333-bib-0051){ref-type="ref"}). These are induced to greater levels in the ischemic brain (Hori et al., [2012](#jnr24333-bib-0034){ref-type="ref"}; Wolinski & Glabinski, [2013](#jnr24333-bib-0080){ref-type="ref"}; Zaremba, Ilkowski, & Losy, [2006](#jnr24333-bib-0082){ref-type="ref"}). Minami et al. reported that the chemokine MCP‐1/CCL2 binding to its respective receptor CCR2 expressed on the brain endothelial surface, leads to dynamic reorganization of the actin cytoskeleton and structural alteration of tight junctions (TJs). This causes a gradual morphological change which was characterized with an upregulated vascular permeability (Stamatovic, Keep, Kunkel, & Andjelkovic, [2003](#jnr24333-bib-0071){ref-type="ref"}). The upregulated or increased vascular permeability leads to the formation of brain edema and is found to be a major reason for death with severe infarction (Ayata & Ropper, [2002](#jnr24333-bib-0005){ref-type="ref"}; Minami, Katayama, & Satoh, [2006](#jnr24333-bib-0060){ref-type="ref"}) (Figure [3](#jnr24333-fig-0003){ref-type="fig"}). ![Mechanism of action of IFN‐β. **(**a) Ischemic injury followed by reperfusion. Within hours of ischemia, upregulation of adhesion molecules expression (e.g., ICAM‐1, VCAM‐1, and E‐selectin,) on the brain endothelial surface. These upregulated adhesion molecules increase the influx of inflammatory cells (e.g., monocytes, neutrophils, B cells, and T cells) to the ischemic brain, causing Infarct formation. IFN‐β reduces the upregulated adhesion molecule expression (e.g., ICAM‐1, VCAM‐1, and E‐selectin) and helps in reducing the infarct formation by decreasing inflammatory cell influx into the brain. (b) After ischemic injury, resting microglial cells are activated and increase the release of matrix metalloproteinase 9 (MMP‐9), tumor necrosis factor α (TNF‐α), monocyte chemoattractant protein‐1 (MCP‐1), interleukin 1B (IL‐1B), IL‐8 which facilitate inflammatory cellinfiltration (monocytes, neutrophils, B cells, and T cells) at the injury site in the brain. Increased infiltration of inflammatory cells compromises the blood--brain barrier (BBB) integrity and leads to secondary brain injury, responsible for increased infarct area in the brain. IFN‐β impairs the ischemia‐induced chemokine (C‐C motif) ligand 3 (CCL3), Chemokine (C‐X‐C motif) ligand 3 (CXCL3), and MMP‐9 expressions and helps to reduce brain infarct. (c) Ischemic injury is followed with reperfusion. Reperfusion increases the peripheral immune cell infiltration (CD45hiCD11b+, CD11b+Ly6G+, CD4+, γδ T Cells) at brain injury and leads to BBB compromise; it leads to BBB disruption and secondary brain injury, results in infarct formation in the brain. IFN‐β lowers the number of infiltrating cells that is, CD45hiCD11b+, CD11b+Ly6G+, CD4+, γδ T Cells in ipsilateral side of the brain and shows a protective role in ischemic stroke by decreasing BBB disruption \[Colour figure can be viewed at <http://wileyonlinelibrary.com>\]](JNR-97-116-g003){#jnr24333-fig-0003} Matrix metallopeptidase‐9 (MMP‐9), released throughout the course of ischemic injury, increases BBB permeability via degradation of extracellular matrix (ECM), TJs in brain endothelium facilitate the inflammatory immune cell infiltration into the CNS (Chaturvedi & Kaczmarek, [2014](#jnr24333-bib-0012){ref-type="ref"}; Lakhan et al., [2009](#jnr24333-bib-0052){ref-type="ref"}). Scientists have reported the significant effect of IFN‐β on the production of MMP‐9 and chemokines in MG, a major producer of inflammatory cytokines implicated as a mediator of neuroinflammation (Kuo et al., [2016](#jnr24333-bib-0051){ref-type="ref"}). It was found that in the ischemic brain, there is a dramatic increase in the expression of CCL3, CXCL3, and MMP‐9 in the ipsilateral part but not in the contralateral part of the brain. IFN‐β treatment helps in reducing the expression of CCL3, CXCL3, and MMP. Kuo et al., have carried out a study to find IFN‐β's inhibitory effect lipopolysaccharide (LPS)‐induced primary MGs. Their results showed that IFN‐β decreased the expression of CCL3, CXCL3, and MMP‐9 in LPS‐activated MGs in a significant manner (Kuo et al., [2016](#jnr24333-bib-0051){ref-type="ref"}) (Figure [3](#jnr24333-fig-0003){ref-type="fig"}). Cerebral ischemic injury followed by reperfusion is mainly responsible for infiltration of peripheral immune cells consisting of T cells, neutrophils, and monocytes/macrophages, resulting in secondary brain injury eventually responsible for increasing the degree of brain infarction (Benakis et al., [2015](#jnr24333-bib-0008){ref-type="ref"}; Wang, Tang, & Yenari, [2007](#jnr24333-bib-0078){ref-type="ref"}). Scientists have also reported that throughout the course of ischemic injury, there is a significant rise in various cell counts including CD11b+Ly6G+ neutrophils and CD45hiCD11b+ monocytes/macrophages in the ipsilateral part of the ischemic brain. In addition, they found that IFN‐β treatment significantly helps in lowering the levels of these cells (Kuo et al., [2016](#jnr24333-bib-0051){ref-type="ref"}) (Figure [3](#jnr24333-fig-0003){ref-type="fig"}). As per previous reports, both CD4+T cells and γδ T cells also playa pathogenic role in ischemic stroke (Gelderblom, Arunachalam, & Magnus, [(2014)](#jnr24333-bib-0027){ref-type="ref"}; Shichita et al., [2009](#jnr24333-bib-0070){ref-type="ref"}). There is arise in the numbers of CD4+T cells and γδT cells in the ischemic brain and this leads to the BBB breakdown and increased infarct size associated with induction of MMP3 and MMP9. IFN‐β treatment reduces both CD4+T cell and γδT cell numbers and decreases the infarct size. IFN‐β treatment suppresses the infiltration of various peripheral immune cells like neutrophils, macrophages/monocytes, and CD4+T cells and γδT cells, providing a protective role in ischemic stroke (Kuo et al., [2016](#jnr24333-bib-0051){ref-type="ref"}) (Figure [3](#jnr24333-fig-0003){ref-type="fig"}). During ischemia, inflammatory processes lead to migration of peripheral blood leukocytes into brain parenchyma, regulated by the adhesion molecules. Adhesion molecules including E‐selectin, P‐selectin, ICAM‐1, and VCAM‐1 are expressed on the activated brain endothelial cell surface and are upregulated after ischemia. They are responsible for facilitating the influx of inflammatory cells and conferring BBB breakdown. Reports suggest that within hours of reperfusion in the middle cerebral artery occlusion/reperfusion (MCAO/R) model in rats, adhesion molecules were found to be upregulated in brain endothelial cells (Kuo et al., [2016](#jnr24333-bib-0051){ref-type="ref"}; Lindsberg, Carpe, Paetau, Karjalainen‐Lindsberg, & Kaste, [1996](#jnr24333-bib-0054){ref-type="ref"}; Zhang, Chopp, Zhang, Jiang, & Powers, [1998](#jnr24333-bib-0083){ref-type="ref"}). Kuo et al. studied that 24‐hr post‐ischemia, there is a significant rise in ICAM‐1 and E‐selectin in the ischemic part of the brain. Further treatment with IFN‐β helps in reducing upregulated ICAM‐1 and E‐selectin in the ipsilateral hemispheres of animals induced with ischemic stroke. Also, there is an increase in VCAM‐1 expression in ischemic stroke, but IFN‐β treatment has not shown any effect on its expression (Kuo et al., [2016](#jnr24333-bib-0051){ref-type="ref"}). They also studied IFN‐β effect on endothelial cell lines bEnd.3. Activation of bEnd.3 cell lines with TNF‐α upregulates ICAM‐1 and E‐selectin at both levels that is, at the genetic level and protein level. They found that IFN‐β treatment helps to obviate TNF‐α‐induced P‐selectin, ICAM‐1, and E‐selectin upregulation but failed inattenuating VCAM‐1 expression which is induced due to TNF‐α on the surface of the cell (Kuo et al., [2016](#jnr24333-bib-0051){ref-type="ref"}; Suárez, Wang, Manes, & Pober, [2010](#jnr24333-bib-0073){ref-type="ref"}) (Figure [3](#jnr24333-fig-0003){ref-type="fig"}). However, the beneficial effect of IFN‐β to counteract ischemic stroke injury remains controversial. It was reported by Maier et al. that IFN‐β failed to protect ischemic injury in a model of transient focal stroke (Maier, Yu, Nishi, Lathrop, & Chan, [2006](#jnr24333-bib-0055){ref-type="ref"}). ### 3.2.1. Limitations of IFN‐β therapy in ischemic stroke {#jnr24333-sec-0010} Since the discovery of IFNs, IFN has progressed from a poorly understood antiviral substance to being FDA‐approved for the treatment of five disorders (Baron et al., [1991](#jnr24333-bib-0007){ref-type="ref"})**.** We have discussed the various mechanisms of IFN**‐**β and its therapeutic potential. However, certain side effects limit the use of IFN‐β (Pestka, [2007](#jnr24333-bib-0064){ref-type="ref"}). Although IFN‐β is usually safe and well tolerated, it causes certain adverse effects. IFNs not only cause local adverse events but systemic adverse reactions as well (Kolb‐Mäurer, Goebeler, & Mäurer, [2015](#jnr24333-bib-0045){ref-type="ref"}). After treatment with IFN‐β, patients have exhibited fatigue, myalgia, headache, malaise, and joint pain (Pestka, [2007](#jnr24333-bib-0064){ref-type="ref"}). Depression has been reported in patients with no prior psychiatric history following IFN‐β therapy (Fragoso et al., [2010](#jnr24333-bib-0022){ref-type="ref"}). Reduced doses of IFN‐β have elicited severe depression and altered tolerability, resulting in discontinuation of treatment (Asnis & De La Garza II, [2005](#jnr24333-bib-0003){ref-type="ref"}). Few studies have demonstrated that endogenous molecules like melatonin, a potent antioxidant and a regulator of circadian rhythm, maybe helpful in mitigating the depressive symptoms associated with IFN‐β (Hansen, Danielsen, Hageman, Rosenberg, & Gögenur, [2014](#jnr24333-bib-0033){ref-type="ref"}). Also, it has been reported that therapy of IFN‐β in combination with L‐methyl folate or S‐adenosyl methionine has varying degrees of outcomes in monotherapy or augmentation therapy for depression (Franscina Pinto & Andrade, [2016](#jnr24333-bib-0023){ref-type="ref"}). However, till date, no studies have been examined in therapeutic treatment of the IFN‐β‐related depressive disorder and should, therefore, be appraised as a possibility in future studies. Thus, IFN‐β therapy may serve as a substantial therapy for the treatment of acute ischemic stroke if the side effects of IFN‐β can be reduced and prevented. 4. CONCLUSION {#jnr24333-sec-0011} ============= Inflammation and immunity are an essential and fundamental parts of the pathogenesis initiated by ischemic and reperfusion injury. Inflammatory cascade is responsible for initiation of early molecular events caused due to blood vessel occlusion and culminates in brain invasion by various inflammatory cells. CNS inflammation, cytotoxicity, BBB disruption, and peripheral immune cell infiltration at the injury site play important roles in secondary brain injury and lead to increased brain infarct. IFN‐β may play protective and multiphasic roles after ischemic stroke. This review focused on the neuroprotective role of IFN‐β in ischemic stroke. As there is a growing body of evidence indicating that inflammatory mediators are predominantly deleterious in the primary phase after ischemic stroke, IFN‐β may be a promising treatment option against ischemic stroke and may be salutary for future adjuvant therapy. With these preclinical findings, IFN‐β has entered the clinical level as a therapeutic agent for ischemic stroke. However, some more substantial findings are required to be carried out in the future for better understanding of ischemic stroke in relation with CNS inflammation, cytotoxicity, BBB dysfunction, and the therapeutic potential of IFN‐β in ischemic stroke. CONFLICT OF INTEREST {#jnr24333-sec-0012} ==================== The authors have no conflict of interest to declare. AUTHOR CONTRIBUTIONS {#jnr24333-sec-0013} ==================== *Conceptualization*, M.W., H.K., D.S. and P.B.; *Methodology*, M.W., H.K., D.S. and P.B.; *Writing -- Original Draft*, H.K., D.S., J.S., K.P., K.V., K.K., A.B., D.Y., K.D., P.B.; *Visualization*, M.W., H.K., D.S., D.Y., K.D., A.B. and P.B.; *Writing -- Review & Editing*, M.W., H.K., D.S., J.S., A.B., K.K., K.D. and P.B. Authors acknowledge Department of Science and Technology (DST), Govt. of India for their financial support through a grant (SB/YS/LS‐196/2014), International Society for Neurochemistry (ISN) Return Home grant, Department of Pharmaceuticals, Ministry of Chemical and Fertilizers, Govt. of India and National Institute of Pharmaceutical Education and Research (NIPER) Ahmedabad, Gandhinagar, India. Authors also want to express their thanks to Boston Children's Hospital, Harvard Medical School, Boston, MA, USA and the Director, NIPER Ahmedabad, for providing necessary support.

Anatomists and Eponyms: The Spirit of Anatomy Past Quick Overview Details About The Book The older traditional Human Anatomical Textbooks included numerous anatomical eponyms. This was a desire to perpetuate the memory of original investigators by associating their names with the anatomical structures that they had discovered. The current trends in most medical school curricula have reduced the subject matter in Human Anatomy to its barest essentials with the elimination of all eponyms. Both students and teachers are now deprived of learning the history associated with many of the former great anatomists.. The objective of this book is therefore to introduce eponyms with pictures or plates depicting the investigator for which the anatomical structure is named. Only the more common eponyms associated with the various anatomical systems of the human body are included.

Recently in an image data processing apparatus it is developed to edit for correcting or modifying images of photographs or pictorial arts by inputting them into personal computers as image data by using an image scanner. However, it becomes need to compress the image data because of increasing of the capacity of a memory device which is necessary for storing the image data and also for an object of implementing a data communication or a data exchange to other apparatus, in accompanied with the increase of image data to be edited. Now, as a high efficiency compression system of a still picture a block encoding system such as the JPEG (Joint Photographic Expert Group) system is commonly used. If these image data compressing systems are supported in a hardware or a software of the image data editing apparatus, the compression of image data for storing may be carried out after the image editing. While if these image data compressing systems are not supported in such a hardware or a software, the compression of the image data may be carried out after storing them with an appropriate image format. FIG. 1 is a block diagram showing one embodiment of the conventional image data compressing apparatus. A user performs an editing work on an image data by using a user interface 11. The image date is processed by a data processing means 12 in response to the input operation of the user. The processed image data is displayed on a monitor of an image display means 13. When storing the processed image data it is stored in a data storing means 15 such as a magnetic disc after compressing by a data compressing means 14. In the image editing operation a paste work for pasting different small image on a base image is frequently carried out. For example it is frequently carried out to paste the image which had been cut out from any other secondary image and stored in a memory, on a primary image to be used as a base image. Here when storing the edited image data by compressing based on the JPEG system, a compression rate or a picture quality extensively varies even though a image paste-in position has been slightly shifted. It is because a result of a quantization or an adaptive DCT processing varies in accordance with where a contour of the image is located within a 8.times.8 pixel block associated with a DCT (an abbreviation of Discrete Cosine Transform) operation. However in a conventional image editing scheme as the editing of image data and a compression for storing images are completely independent to each other, it is not taken into account for an effect which a slight shift of the image paste-in position largely influences on the compression rate or the picture quality. As described above, the conventional image data processing apparatus has such problems that as the editing of image data and a compression fop storing images are completely independent to each other, it is not taken into account for an effect which a slight shift of the image paste-in position largely influences on the compression rate or the picture quality thus causing the image data after compression to be left in large amount of volume.

1. Field of the Invention The object of the present invention is a display screen without moire effect. It finds an application in the production of any display devices, notably with micropoints, also referred to as the field emission display type (or FED for short). "Without" moire effect means a moire effect which is sufficiently attenuated so as not to be visible to an observer. 2. Discussion of the Background Although the invention is not limited to this type of display, it is in the case of field emission display screens that the state of the art will be described. A field emission display screen is described notably in the document FR 2 623 013. The essentials of this device are depicted in the accompanying FIGS. 1 and 2. The device depicted in these figures comprises, on a substrate 2, for example made of glass, a thin layer of silica 4 and, on this layer, a plurality of electrodes 5 in the form of parallel conductive bands fulfilling the role of cathodic conductors and constituting addressing columns. These cathodic conductors are covered with a continuous resistive layer 7 (except on the ends to allow the connection of the cathodic conductors with biasing means 20). An electrically insulating layer 8, made of silica, covers the resistive layer 7. Above the insulating layer 8 there are formed a plurality of electrodes 10 also in the form of parallel conductive bands. These electrodes 10 are perpendicular to the electrodes 5 and fulfill the role of a grid constituting the addressing lines. The device also has a plurality of elementary emitters of electrons (micropoints), only one example of which (for reasons of simplification) is depicted schematically in FIG. 2: in each of the intersection areas (corresponding to an image point or pixel) cathodic conductors 5 and grids 10, the resistive layer 7 corresponding to this area supports micropoints 12, for example made of molybdenum, and the grid 10 corresponding to the said area has an opening 14 opposite each of the micropoints 12. Each of the latter adopts substantially the shape of a cone whose base rests generally on the layer 7 and whose apex is situated level with the corresponding opening 14. Naturally, the insulating layer 8 is also provided with openings 15 allowing passage of the micropoints 12. This first subassembly defined by the area of intersection of the cathodic conductors and grid conductors 10, possibly associated with other elements, for example a supplementary grid within the screen or a filter on the face of the screen observed, can be referred to as an "intermediate subassembly". Thus each intermediate subassembly corresponds to a pixel. Opposite this intermediate subassembly, there is a substrate 30 covered with a conductive layer 32 serving as an anode. This layer is covered with a layer or bands of luminescent materials 34. Hereinafter the emissive part opposite the pixel (or intermediate subassembly) will be referred to as the "anode subassembly". In the case of a monochrome screen, or an unswitched three-color screen, the size of the anode subassembly corresponds to that of the intermediate subassembly. In the case of a switched three-color screen, the pixel is opposite three bands of luminescent materials, only one of which emits at a time, and the anode subassembly corresponds to the excited band part. The light emitted by the luminous materials under the impact of the electrons emitted by the micropoints is received by the observer 0. In the usual case, the observation takes place on the anode side, and therefore through the anode subassembly, on the side opposite the excitation of the luminescent materials. However, the major part of the light being emitted on the excitation side, the result is that it is highly advantageous to observe this screen on the excitation side of the luminescent materials, and therefore through the intermediate subassembly which, because of this, must be at least partially transparent. This operating mode is all the more advantageous since the entire quantity of light emitted can be reflected towards the intermediate subassembly by the use of a reflective layer disposed behind the luminescent materials (this layer can be the anode itself or a supplementary layer, for example of aluminium). In addition, as the intermediate subassembly is partially transparent, it fulfills the role of a neutral filter and thus reduces the effects related to diffuse reflection, in the case notably where the luminescent materials are powder luminophores. The intermediate subassembly defined by the intersection of an addressing row and column can take various forms. In one embodiment described in the document FR-A-2 687 839, the cathodic conductors have a lattice structure and the grid conductors a perforated structure. This embodiment is illustrated in FIGS. 3A and 3B, which are respectively plan and cross-sectional views. In these figures, the cathodic conductors bear the reference 5a and the grid conductors the reference 10g. The grids have openings 11 opposite the areas of intersection of the conductive tracks 5a and are centered on these areas, as can be seen in FIG. 3A. Naturally, the grids also have holes 14a respectively opposite the micropoints 12. More precisely, each grid 10g has substantially the structure of a lattice identical to the lattice of the corresponding cathodic conductor, but the lattice of this grid is offset, with respect to the lattice of the cathodic conductor, by a half-pitch parallel to the addressing rows and a half-pitch parallel to the addressing columns. Above an area where micropoints are collected, this grid has, in plan view, a square surface 10a which has holes 14a in it and at which there end four tracks 10b forming part of the lattice of this grid. Many other embodiments are possible, but it will be understood that the intermediate subassembly, through which the observation is effected, though it is semi-transparent overall, is, in reality, formed by highly diverse areas if it is examined on a small scale. Each pixel defined by the overlapping of an addressing row and column therefore comprises a central area (which will be referred to as the "pupil" of the pixel) and four lateral half-parts. The four lateral parts separate each area from its four neighbours. Each pixel therefore has an optical transmission which is not uniform. FIG. 4 shows the appearance of such a pixel, where the central part 40 can be discerned, with its repetitive subassemblies corresponding to the meshing of the grid conductor and of the cathode conductor, and the lateral parts 42a, 42b, 42c, 42d. This complex periodic structure of the intermediate subassembly, superimposed on the structure, also periodic, of the anode subassembly (in terms of emission as previously defined) can lead to display defects due to moire effects. These defects are illustrated in FIGS. 5a and 5b, on the one hand, and in FIG. 6 on the other hand. FIGS. 5A and 5B, first of all, correspond to the case where the intermediate subassembly and the anode subassembly are not strictly aligned. This appears when there are several bands of luminescent materials (three-color screen, switched or otherwise). It is assumed that the columns of luminescent materials disposed on the anode are not strictly parallel to the addressing columns of the intermediate subassembly. FIGS. 5A and 5B are sections along a plane perpendicular to the columns, at two different points on the screen (for example at the top and at the bottom). In these two figures, the intermediate subassembly bears the general reference 50 and is depicted schematically with regions 52 corresponding to the central part of the pixels, relatively transparent areas, and half-regions 54 corresponding to the lateral half-areas, less transparent; the anode subassembly is depicted in the form of the emissive luminous band 62. FIGS. 5A and 5B depict, by way of example, the case of a three-color screen, switched or otherwise. Since the light is not transmitted from the luminescent bands to the observer in the same way from one end of the column to the other, the image perceived will be interfered with by lines or fringes which are more or less bright and coloured. This moire effect is a nuisance to the observer. FIG. 6 also shows, in the case of both a monochrome screen and a three-color screen, switched or otherwise, that the light flux emitted by an anode subassembly 62 is not strictly the same in the direction of an observer 70 facing the subassembly 62 and in the direction of an observer 72 placed to the side, whatever the direction of the movement. The variations in transparency on the pixel scale and on the scale of each anode subassembly therefore gives rise to parasitic effects, which impair the quality of the displayed image. The aim of the present invention is precisely to remedy these drawbacks.

--- abstract: 'The parity-nonconserving asymmetry in the deuteron photodisintegration, $\vec{\gamma}+d\rightarrow n+p$, is considered with the photon energy ranged up to 10 MeV above the threshold. The aim is to improve upon a schematic estimate assuming the absence of tensor as well as spin-orbit forces in the nucleon-nucleon interaction. The major contributions are due to the vector-meson exchanges, and the strong suppression of the pion-exchange contribution is confirmed. A simple argument, going beyond the observation of an algebraic cancellation, is presented. Contributions of meson-exchange currents are also considered, but found to be less significant.' author: - 'C.-P. Liu' - 'C. H. Hyun' - 'B. Desplanques' bibliography: - 'QEPV.bib' - 'MEC.bib' - 'AM.bib' - 'npPV.bib' title: Parity Nonconservation in the Photodisintegration of the Deuteron at Low Energy --- Introduction \[sec:intro\] ========================== Some interest, both experimental and theoretical, has recently been shown for the study of parity nonconservation in the deuteron photodisintegration by polarized light. Historically, it was its inverse counterpart: the net polarization in radiative thermal neutron capture by proton, $n+p\rightarrow d+\gamma$, which attracted the first attention [@Danilov:1965]. The experimental study was performed by the Leningrad group, taking advantage of new techniques measuring an integrated current [@Lobashov:1972]. The non-zero polarization obtained, $P_{\gamma}=-(1.3\pm0.45)\times10^{-6}$, motivated many theoretical calculations in the frame of strong and weak interaction models known in the 70’s (see for instance Refs. [@Lassey:1975; @Desplanques:1975; @Craver:1976am]). The theoretical results were consistently within the range $P_{\gamma}=(2\sim5)\times10^{-8}$, which is smaller than the measurement by a factor of 30 or more in magnitude and, moreover, of opposite sign. The difficulty to understand the measurement and, also perhaps, the novelty of the techniques, which have been extensively used later on, led to a special reference to this work as “Lobashov experiment”. Later estimates with modern nucleon-nucleon ($NN$) potentials, both parity-conserving (PC) and parity-nonconserving (PNC), give values of $P_{\gamma}$ roughly within the same theoretical range as above. On the experimental side, new results were reported in the early 80’s by the same Leningrad group, giving $P_{\gamma}\leq5\times10^{-7}$ [@Knyazkov:1983ke] and $P_{\gamma}=(1.8\pm1.8)\times10^{-7}$ [@Knyazkov:1984]. Practically, these results indicate an upper limit of $P_{\gamma}$, which is not very constrictive. Since Leningrad group’s last report, the “Lobashov experiment” has long been forgotten by both experimentalists and theorists. Recent experiments such as elastic $\vec{p}$-$p$ scattering (TRIUMF [@Berdoz:2001nu]) and polarized thermal neutron capture by proton (LANSCE [@Snow:2000az]), which directly address the problem of PNC $NN$ interactions; and quasi-elastic $\vec{e}$-$d$ scattering (MIT-Bates [@SAMPLE00b; @Ito:2003mr]), which indirectly involves these interactions, have however raised a new interest for the study of PNC effects in few-body systems. In what could be a golden age for these studies, the “Lobashov experiment” is again evoked. While it seems that there is not much prospect for performing the “Lobashov experiment” in a near future, the inverse process, on the contrary, could be more promising. In this reaction, $\vec{\gamma}+d\rightarrow n+p$, where a deuteron is disintegrated by absorbing a circularly polarized photon, it is expected that, near threshold, the PNC asymmetry ($A_{\gamma}$) is equal to the polarization in the “Lobashov experiment”. This last one can thus be tested from a different approach. The asymmetry $A_{\gamma}$ in the deuteron photodisintegration was first calculated by Lee [@Lee:1978kh] up to the photon energy $\omega_{\gamma}\simeq3.22$ MeV, which is 1 MeV above the threshold. In this energy domain, where the dominant regular transition is $M1$, the result was within the theoretical range of $P_{\gamma}$. Later on, Oka extended Lee’s work, up to $\omega_{\gamma}\simeq35$ MeV [@Oka:1983sp]. Though the cross section still receives a contribution from the $M1$ transition, the dominant contribution comes from the $E1$ transitions. This offers a pattern of PNC effects different from the one at very low photon energy. It was found that $A_{\gamma}$ shows a great enhancement at $\omega_{\gamma}\gtrsim5$ MeV, mainly due to the PNC $\pi$-exchange contribution. If such an enhancement were observed in the experiment, it would provide an important and unambiguous determination of the weak $\pi NN$ coupling constant $h_{\pi}^{1}$. However, a recent schematic calculation of $A_{\gamma}$ by Khriplovich and Korkin [@Khriplovich:2000mb], partly suggested by one of the present author, showed critical contradiction to Oka’s result, with a huge suppression of $A_{\gamma}$ at the energies $\omega_{\gamma}\gtrsim3$ MeV. On the experimental side, a measurement of the asymmetry $A_{\gamma}$ in $\vec{\gamma}+d\rightarrow n+p$ was considered in the 80’s by E. D. Earle *et al.* [@Earle:1981; @Earle:1988fc] but no sensitive result was reported. However, due to advances in experimental techniques and instrumentation, the measurement of $A_{\gamma}$ becomes more feasible nowadays and several groups at JLab [@jlab-lett00], IASA (Athens), LEGS (BNL), TUNL, and SPring-8 show interest in such a measurement. It is therefore important to understand and improve previous estimates. In this work, we carefully re-examine the $\vec{\gamma}+d\rightarrow n+p$ process with two main purposes: 1. Determine how the enhancement of the $h_{\pi}^{1}$ contribution in Oka’s results will change when the calculation is completed with missing parity-admixed components in the final state, in particular in the $^{3}P_{1}$ channel. The role of this last one was revealed by the schematic estimate of Ref. [@Khriplovich:2000mb]. 2. Determine the uncertainty of Khriplovich and Korkin’s calculation in which very simple wave functions are used. It is straightforward to deal with the point 1. In Ref. [@Khriplovich:2000mb], a nice and simple argument about the cancellation of the $h_{\pi}^{1}$ contribution from the final $^{3}P_{0}$, $^{3}P_{1}$, and $^{3}P_{2}$ states along with their parity-admixed partners was given. However, the argument assumed the absence of tensor as well as spin-orbit forces, which are important components of the $NN$ interaction. In order to address these two points (missing components and simplicity of the wave functions), we elaborate our calculation with the Argonne $v_{18}$ $NN$ interaction model. We thus include the $^{1}S_{0}$, $^{3}P_{0}$, $^{3}P_{1}$, $^{3}P_{2}$–$^{3}F_{2}$ channels, deuteron $D$-state, and all their parity-admixed partners consistently. They represent a minimal set of states that allows one to verify the results of the schematic model as well as to include the effect of the tensor and spin-orbit forces that manifest differently in these various channels. We also include other channels, whose role is less important however. As for the $E1$ operator, we employ the Siegert’s theorem [@Siegert:1937yt], which takes into account the contribution of some PC and PNC two-body currents. The small photon energy considered here ($\omega_{\gamma}\leq12$ MeV) justifies this usage. Since there is no theorem similar to the Siegert one for the $M1$ transition operator, two-body currents have to be considered explicitly for both the PC and PNC parts. Adopting Desplanques, Donoghue, Holstein (DDH) potential of the weak interaction [@Desplanques:1980hn], the asymmetry $A_{\gamma}$ will be expressed in terms of the weak $\pi NN$, $\rho NN$ and $\omega NN$ coupling constants, with corresponding coefficients indicating their relative importance. This paper is organized as follows. In Sect. \[sec:formalism\], we review the basic formalism underlying the calculation, which involves both one- and two-body currents. In Sect. \[sec:results\], we show the results and some discussions follow. A particular attention is given to a comparison with earlier works and to new contributions from PNC two-body currents. A simple argument explaining the suppression of the pion-exchange contribution is also given. Conclusions are given in Sect. \[sec:conclusion\]. An appendix contains expressions of $E1$ and $M1$ transition amplitudes due to the PNC two-body currents considered in the present work. Formalism\[sec:formalism\] ========================== For a photodisintegration of an unpolarized target, the asymmetry factor is defined as $$A_{\gamma}\equiv\frac{\sigma_{+}-\sigma_{-}}{\sigma_{+}+\sigma_{-}}\,,$$ where $\sigma_{+(-)}$ denotes the total cross section using right- (left-) handed polarized light. By spherical multipole expansion, it could be expressed as$$A_{\gamma}=\frac{{\displaystyle 2\,\mathrm{Re}\,\sum_{f,i,J}\,\left[F_{EJ}^{*}\,\tilde{F}_{MJ_{5}}+F_{MJ}^{*}\,\tilde{F}_{EJ_{5}}\right]}}{{\displaystyle \sum_{f,i,J}\,\left[F_{EJ}^{2}+F_{MJ}^{2}\right]}}\,.\label{eq:asym}$$ In this formula, the normal electromagnetic (EM) and PNC-induced EM form factors, $F_{XJ}$ and $\tilde{F}_{XJ_{5}}$, with $X$ and $J$ denoting the type and multipolarity of the transition between a specific initial ($i$) and final ($f$) states, are defined in the same way as Refs. [@Musolf:1994tb; @Liu:2002bq]. They depend on the momentum transfer $q$, which equals to the photon energy $\omega_{\gamma}$ in this current case. The form factors $\tilde{F}_{XJ_{5}}$ (and so does the asymmetry) vanish unless some PNC mechanism induces parity admixtures of wave functions and axial-vector currents. In this work, we consider the photon energy $\omega_{\gamma}=q$ up to 10 MeV above the threshold. As the long wavelength limit, $\langle q\, r\rangle\ll1$, is a good approximation, the inclusion of only dipole transitions, *i.e.* $E1$ and $M1$, is sufficient. This leads to 10 possible exit channels connected to the deuteron state by angular momentum considerations. Among them, $^{1}S_{0}$, via the $M1$ transition, and $^{3}P_{0}$, $^{3}P_{1}$, $^{3}P_{2}$–$^{3}F_{2}$, via the $E1$ transitions, dominate the cross section. The transverse multipole operators assume a full knowledge of nuclear currents. This requires, besides the one-body current $\bm j^{(1)}$ from individual nucleons, a complete set of two-body exchange currents (ECs) $\bm j^{(2)}$ which is consistent with the nucleon-nucleon ($NN$) potential. These ECs are usually the sources of theoretical uncertainties, because the $NN$ dynamics is still not fully understood. While there is no alternative for the evaluation of $F_{MJ}$, the Siegert theorem [@Siegert:1937yt] does allow one to transform the evaluation of $F_{EJ}$ into the one of charge multipole $F_{CJ}$. The fact that the PC $NN$ interaction does not give rise to exchange charges at $O(1)$ removes most of the uncertainties related to exchange effects: knowledge of the one-body charge $\rho^{(1)}$ is sufficient for a calculation good to the order of $1/\mN$. In the framework of impulse approximation and using the Siegert theorem, one gets, for the deuteron photodisintegration ($E_{f}-E_{i}=\omega_{\gamma}=q$ and $J_{i}=1$), $$\begin{aligned} F_{E1}^{(S)}(q)_{f,i} & = & \frac{E_{i}-E_{f}}{q}\,\sqrt{\frac{2}{2J_{i}+1}}\,\bra{J_{f}}|\int\, d^{3}x\,[j_{1}(q\, x)\, Y_{1}(\Omega_{x})]\,\rho^{(1)}(\bm x)|\ket{J_{i}}\nonumber \\ & & +\frac{1}{q}\,\frac{1}{\sqrt{2J_{i}+1}}\,\bra{J_{f}}|\int\, d^{3}x\,\bm\nabla\times[j_{1}(q\, x)\,\bm Y_{111}(\Omega_{x})]\cdot\bm j_{spin}^{(1)}(\bm x)|\ket{J_{i}}\nonumber \\ & \simeq & -\frac{q}{3\sqrt{2\,\pi}}\,\bra{J_{f}}|\sum_{i}\,\hat{e}_{i}\,\bm x_{i}|\ket{J_{i}}\equiv-\frac{q}{2\,\sqrt{6\,\pi}}\,\langle E1^{(1)}\rangle\,,\label{eq:Siegert E1}\\ F_{M1}^{(1)}(q)_{f,i} & = & i\,\frac{1}{\sqrt{2J_{i}+1}}\,\bra{J_{f}}|\int\, d^{3}x\,[j_{1}(q\, x)\,\bm Y_{111}(\Omega_{x})]\cdot\bm j^{(1)}(\bm x)|\ket{J_{i}}\nonumber \\ & \simeq & -\frac{q}{3\sqrt{2\,\pi}}\,\bra{J_{f}}|\sum_{i}\,\frac{1}{2\mN}\,[\hat{e}_{i}\,\bm x_{i}\times\bm p_{i}+\hat{\mu}_{i}\,\bm\sigma_{i}]|\ket{J_{i}}\,\equiv-\frac{q}{2\,\sqrt{6\,\pi}}\,\langle M1^{(1)}\rangle\,,\end{aligned}$$ where $\hat{e}_{i}=e\,(1+\tau_{i}^{z})/2$ and $\hat{\mu}_{i}=e\,(\muS+\muV\tau_{i}^{z})/2$ with $\muS=0.88$ and $\muV=4.70$; $Y$ and $\bm Y$ are the spherical and vector spherical harmonics. In these expressions, the approximated results are obtained by replacing the spherical Bessel function $j_{1}(q\, x)$ with its asymptotic form as $q\rightarrow0$, *i.e.* $q\, x/3$, at the long wavelength limit and keeping terms linear in $q$ (the lowest order); they could be related to the forms of $\langle E1^{(1)}\rangle$ and $\langle M1^{(1)}\rangle$ often adopted in the literature. In our numerical calculation, the identity relations are employed instead. Note that the one-body spin current is conserved by itself and not constrained by current conservation. In Eq. (\[eq:Siegert E1\]), this one-body spin current (2nd line) is of higher order in $q$ compared with the Siegert term (1st line), however, it is kept for completeness. As for the PNC-induced form factors $\tilde{F}_{E1_{5}}^{(S)}$ and $\tilde{F}_{M1_{5}}^{(1)}$, one only has to replace either the initial or final state by its opposite-parity admixture, $\widetilde{{\bra{J_{f}}}}$ or $\widetilde{{\ket{J_{i}}}}$, and add a factor “$i$” for $E1$ or “$-i$” for $M1$ matrix elements (in relation with our conventions). The non-vanishing matrix elements for the five dominant exit channels are thus 1. $^{1}S_{0}$:$$\begin{aligned} \langle M1^{(1)}\rangle & = & -\frac{\muV}{\mN}\,\int\, dr\, U^{*}(^{1}S_{0})\, U_{d}(^{3}S_{1})\,,\label{eq:comp-i}\\ \langle E1_{5}^{(1)}\rangle & = & \frac{i}{3}\,\int\, r\, dr\,\tilde{U}^{*}(^{3}P_{0})\,\left[U_{d}(^{3}S_{1})-\sqrt{2}\, U_{d}(^{3}D_{1})\right]\nonumber \\ & & -\frac{i}{\sqrt{3}}\,\int\, r\, dr\, U^{*}(^{1}S_{0})\,\tilde{U}_{d}(^{1}P_{1})\,.\end{aligned}$$ 2. $^{3}P_{0}$:$$\begin{aligned} \langle E1^{(1)}\rangle & = & \frac{1}{3}\,\int\, r\, dr\, U^{*}(^{3}P_{0})\,\left[U_{d}(^{3}S_{1})-\sqrt{2}\, U_{d}(^{3}D_{1})\right]\,,\\ \langle M1_{5}^{(1)}\rangle & = & i\,\frac{\muV}{\mN}\,\int\, dr\,\left[\tilde{U}^{*}(^{1}S_{0})\, U_{d}(^{3}S_{1})-\frac{1}{\sqrt{3}}\, U^{*}(^{3}P_{0})\,\tilde{U}_{d}(^{1}P_{1})\right]\nonumber \\ & & -\, i\,\sqrt{\frac{2}{3}}\,\frac{\muS-1/2}{\mN}\,\int\, dr\, U^{*}(^{3}P_{0})\,\tilde{U}_{d}(^{3}P_{1})\,.\label{eq:comp-ia}\end{aligned}$$ 3. $^{3}P_{1}$:$$\begin{aligned} \langle E1^{(1)}\rangle & = & -\frac{1}{\sqrt{3}}\,\int\, r\, dr\, U^{*}(^{3}P_{1})\,\left[U_{d}(^{3}S_{1})+\frac{1}{\sqrt{2}}\, U_{d}(^{3}D_{1})\right]\,,\\ \langle M1_{5}^{(1)}\rangle & = & -\, i\,\frac{\muV}{\mN}\,\int\, dr\, U^{*}(^{3}P_{1})\,\tilde{U}_{d}(^{1}P_{1})-i\,\frac{\muS+1/2}{\sqrt{2}\,\mN}\,\int\, dr\, U^{*}(^{3}P_{1})\,\tilde{U}_{d}(^{3}P_{1})\nonumber \\ & & -\, i\,\frac{\sqrt{2}\,\muS}{\mN}\,\int\, dr\,\tilde{U}^{*}(^{3}S_{1})\, U_{d}(^{3}S_{1})+i\,\frac{\muS-3/2}{\sqrt{2}\,\mN}\,\int\, dr\,\tilde{U}^{*}(^{3}D_{1})\, U_{d}(^{3}D_{1})\,.\label{eq:comp-ib}\end{aligned}$$ 4. $^{3}P_{2}$–$^{3}F_{2}$:$$\begin{aligned} \langle E1^{(1)}\rangle & = & \frac{\sqrt{5}}{3}\,\int\, r\, dr\,\bigg\{ U^{*}(^{3}P_{2})\,\left[U_{d}(^{3}S_{1})-\frac{1}{5\,\sqrt{2}}\, U_{d}(^{3}D_{1})\right]\,\nonumber \\ & & +\frac{3\,\sqrt{3}}{5}\, U^{*}(^{3}F_{2})\, U_{d}(^{3}D_{1})\bigg\}\,,\\ \langle M1_{5}^{(1)}\rangle & = & -\, i\,\sqrt{\frac{5}{3}}\,\frac{\muV}{\mN}\,\int\, dr\,\left[U^{*}(^{3}P_{2})\,\tilde{U}_{d}(^{1}P_{1})-\sqrt{\frac{3}{5}}\,\tilde{U}^{*}(^{1}D_{2})\, U_{d}(^{3}D_{1})\right]\nonumber \\ & & +i\,\sqrt{\frac{5}{6}}\,\frac{\muS-1/2}{\mN}\,\int\, dr\,\left[U^{*}(^{3}P_{2})\,\tilde{U}_{d}(^{3}P_{1})+\frac{3}{\sqrt{5}}\,\tilde{U}^{*}(^{3}D_{2})\, U_{d}(^{3}D_{1})\right]\,.\label{eq:comp-f}\end{aligned}$$ Results for the remaining five less important channels ($^{3}S_{1}$–$^{3}D_{1}$, $^{1}P_{1}$, $^{1}D_{2}$, $^{3}D_{2}$) will be included in numerical works. The $r$-weighted radial wave functions for scattering and deuteron states, $U$ and $U_{d}$, along with their parity admixtures, $\tilde{U}$ and $\tilde{U}_{d}$, are obtained by solving the Schrödinger equations. Details could be found in Ref. [@Liu:2002bq]. By taking the square of normal EM form factors (PC response function) or the product of normal and PNC-induced ones (PNC response function), we can directly compare Eqs. (5a–5h) in Ref. [@Oka:1983sp]. After removing factors due to wave-function normalizations, the differences are: 1. The parity admixture of the scattering $^{3}P_{1}$ state is included in our work: The admixtures $\tilde{U}(^{3}S_{1})$ and $\tilde{U}(^{3}D_{1})$ are solved from the inhomogeneous differential equations with the source term modulated by $U(^{3}P_{1})$. They are not orthogonal to the deuteron state and thus should not be ignored. Actually, they are required to ensure the orthogonality of the deuteron and the $^{3}P_{1}$ scattering states once these ones are allowed to contain a parity-nonconserving component. 2. The terms involving the scalar magnetic moment are different: Looking for instance at the $M1$ matrix element between $U(^{3}P_{1})$ and $\tilde{U}_{d}(^{3}P_{1})$, the effective $M1$ operator is proportional to $\muS\,\bm S+\bm L/2$. By the projection theorem, $\langle\bm S\rangle=\langle\bm L\rangle$, the overall factor should be $\muS+1/2$, not $\muS+1$ as in Ref. [@Oka:1983sp].[^1] It looks as if this work ignored the $1/2$ factor in front of the $\bm L$ operator. Both points involve the spin-conserving PNC interaction, which is dominated by the pion exchange. Therefore, how these differences change the sensitivity of $A_{\gamma}$ with respect to $h_{\pi}^{1}$ will be elaborated in next section. Now we discuss, in two steps, extra contributions due to ECs when one tries to go beyond the impulse approximation together with the Siegert-theorem framework. First, when PC ECs are included, their contribution to $M1$ matrix elements, $F_{M1}^{(2)}$, definitely needs to be calculated. On the other hand, as PC exchange charges are higher-order in the nonrelativistic limit, $F_{E1}^{(S)}$ is supposed to take care of most two-body effects, and the remaining contribution $\Delta F_{E1}^{(2)}$ can be safely ignored. This argument also applies for the PNC-induced form factors involving the PC ECs: one needs to consider $\tilde{F}_{M1_{5}}^{(2)}$ but can leave out $\Delta\tilde{F}_{E1_{5}}^{(2)}$. Second, the inclusion of PNC ECs, to the first order in weak interaction, only affects the PNC-induced form factors. The contribution $\tilde{F}_{M1_{5}}^{(2')}$ is calculated by using the $M1$ operator constructed from the PNC ECs and unperturbed wave functions (so we use a prime to remind the difference from parity-admixture contributions). One special feature of PNC ECs is that they do have exchange charges of $O(1)$ [@Liu:2003au]. Therefore, one should include them in $\tilde{F}_{E1_{5}}^{(S')}$. As a last remark, we note one advantage of nuclear PNC experiments in processes like photodisintegration or radiative capture. The real photon is “blind” to the nucleon anapole moment, which could contribute otherwise to PNC observables in virtual photon processes. Because this P-odd T-even nucleon moment is still poorly constrained both theoretically and experimentally, the interpretation of real-photon processes, like the one considered here, is thus comparatively easier. Results and Discussions \[sec:results\] ======================================= For practical purposes, we use the Argonne $v_{18}$ [@Wiringa:1995wb] (A$v_{18}$) and DDH [@Desplanques:1980hn] potentials as the PC and PNC $NN$ interactions, respectively. In comparison with earlier works in the 70’s or the 80’s, a strong interaction model like A$v_{18}$ offers the advantage that the singlet-scattering length is correctly reproduced, due to its charge dependence. Correcting results with this respect is therefore unnecessary. The total cross section is plotted in Fig. \[cap:cross section\] as a function of the photon energy and labeled as “IA+Sieg”. Its separate contributions from $E1$ and $M1$ transitions are also shown on the same plot (labeled accordingly). The $M1$ transition only dominates near the threshold region; as the photon energy reaches about 1 MeV above the threshold, the $E1$ transition overwhelms. Away from the threshold, the calculated results agree well with both experiment and existing potential-model calculations up to 10 MeV [@Arenhovel:1991]. Such a good agreement shows the usefulness of the Siegert theorem, by which most of the two-body effects are included. Compared with the curve labeled by “IA”, the result of impulse approximation, one sees the increasing importance of these two-body contributions as $\omega_{\gamma}$ gets larger. On the contrary, because $M1$ matrix elements are purely one-body, we expect our near-threshold results smaller than experiment by about $10\%$ [@Arenhovel:1991]. This discrepancy, originally found in the radiative capture of thermal neutron by proton (the inverse of deuteron photodisintegration), requires various physics such as exchange currents and isobar configurations, to be fully explained. Here, we qualitatively estimate a $5\%$ error for the calculation of $F_{M1}$ near threshold. When calculating the PNC-induced matrix elements with the DDH potential, we use the strong meson-nucleon coupling constants: $g_{\pi\ssst{NN}}=13.45$, $g_{\rho\ssst{NN}}=2.79$, and $g_{\omega\ssst{NN}}=8.37$, and meson masses (in units of MeV): $m_{\pi}=139.57$, $m_{\rho}=770.00$, and $m_{\omega}=781.94$. The resulting asymmetry is then expressed in terms of six PNC meson-nucleon coupling constants $h$’s as $$A_{\gamma}=c_{1}\, h_{\pi}^{1}+c_{2}\, h_{\rho}^{0}+c_{3}\, h_{\rho}^{1}+c_{4}\, h_{\rho}^{2}+c_{5}\, h_{\omega}^{0}+c_{6}\, h_{\omega}^{1}\,,\label{eq:A exp}$$ where the six energy-dependent coefficients $c_{1...6}$ show the sensitivity to each corresponding coupling. It turns out that, for the energy range considered here, $c_{2},\, c_{4},\, c_{5}\gg c_{1}\gg c_{3},\, c_{6}$. This implies the asymmetry has a larger sensitivity to the isoscalar and isotensor couplings than to the isovector ones. The detailed energy dependences of these “large” and “small” coefficients are shown in Fig. \[cap:coeffs\]. In principle, these results are independent. In practice however, they can be shown to depend on three quantities, reflecting the dominant role of the various $S\leftrightarrow P$ neutron-proton transition amplitudes at low energy. These amplitudes have some energy dependence which is essentially determined by the best known long-range properties of strong interaction models. They can therefore be parametrized by their values at zero energy [@Danilov:1965; @Missimer:1976wb; @Desplanques:1978mt], including at the deuteron pole. To a large extent, they can be used independently of the underlying strong interaction model, quite in the spirit of effective-field theories that they anticipated [@Holstein]. In the case of the A$v_{18}$ model employed here, they are given by: $$\begin{aligned} \mN\,\lambda_{t} & = & -0.043\, h_{\rho}^{0}-0.022\, h_{\omega}^{0}\,,\nonumber \\ \mN\,\lambda_{s} & = & -0.125\, h_{\rho}^{0}-0.109\, h_{\omega}^{0}+0.102\, h_{\rho}^{2}\,,\nonumber \\ \mN\, C & = & 1.023\, h_{\pi}^{1}+0.007\, h_{\rho}^{1}-0.021\, h_{\omega}^{1}\,.\end{aligned}$$ The largest corrections to the above approach occur for the PNC pion-exchange interaction which, due to its long range, produces some extra energy dependence and sizable $P\leftrightarrow D$ transition amplitudes. They can show up when the contribution of the $S\leftrightarrow P$ transition amplitude is suppressed, like in this work. For $\omega_{\gamma}=2.235$ MeV, which is very close to the disintegration threshold, we get the asymmetry $$\begin{aligned} A_{\gamma}^{(th)} & \approx & \left[-8.44\, h_{\rho}^{0}-17.65\, h_{\rho}^{2}+3.63\, h_{\omega}^{0}\right.\nonumber \\ & & \left.\hspace{2cm}+O(c_{1},c_{3},c_{6})\right]\times10^{-3}\,.\label{eq:A-threshold}\end{aligned}$$ Using the DDH “best” values as an estimate, we got $A_{\gamma}^{(th)}\approx2.53\times10^{-8}$. By detailed balancing, one expects that $A_{\gamma}^{(th)}$ equals the circular polarization $P_{\gamma}^{(th)}$ observed in the radiative thermal neutron capture by proton, given the same kinematics. Though our result does not exactly correspond to the same kinematics as the inverse process usually considered (the kinetic energy of thermal neutrons $\sim$0.025 eV), it agrees both in sign and order of magnitude with existing calculations of $P_{\gamma}^{(th)}$ [@Lassey:1975; @Desplanques:1975; @Craver:1976am]. We also performed a similar calculation for the latter case with A$v_{18}$, and the result is $$\begin{aligned} P_{\gamma}^{(th)} & \approx & \left[-8.75\, h_{\rho}^{0}-17.47\, h_{\rho}^{2}+3.39\, h_{\omega}^{0}\right.\nonumber \\ & & \left.\hspace{2cm}+O(c_{1},c_{3},c_{6})\right]\times10^{-3}\,.\end{aligned}$$ This is very close to the result of $A_{\gamma}$ quoted above. It is noticed that our expression of $A_{\gamma}^{(th)}$ at very low energy, and therefore that one for $P_{\gamma}^{(th)}$, contains a contribution from the one-pion exchange (see the low-energy part of the $c_{1}$ coefficient given in Fig. \[cap:coeffs\]). This feature, which apparently contradicts the statement often made in the past that this contribution is absent in $P_{\gamma}^{(th)}$, is due to the incorporation in our work of the spin term in Eq. (\[eq:Siegert E1\]), which represents a higher order term in $q$. This correction also explains the difference in the behavior of the $c_{1}$ coefficient with the Oka’s result [@Oka:1983sp]. We note that, because the $M1$ transition dominates at the threshold and we only use the impulse approximation for its matrix element, there should be approximately a $-5\%$ correction to $A_{\gamma}^{(th)}$ (also $P_{\gamma}^{(th)}$) when two-body effects are included in $F_{M1}$. On the other hand, as $\tilde{F}_{E1_{5}}$ is calculated using the Siegert theorem, it should be reliable up to the correction of $\tilde{F}_{E1_{5}}^{(S')}$ from the PNC exchange charge at $O(1)$. When the photon energy gets larger, one can see immediately that the asymmetry gets smaller. A prediction using the DDH best values is shown in Fig. \[cap:Ag DDH\]. In this figure, as soon as the photon energy reaches 1 MeV above the threshold, the asymmetry drops by one order of magnitude. Moreover, the sign changes around $\omega_{\gamma}=4$ MeV. This implies that a higher sensitivity ($\sim10^{-9}$) is needed for any experiment targeting at the kinematic range away from the threshold. Our calculation is consistent with the work by Khriplovich and Korkin [@Khriplovich:2000mb], but is widely different from the one by Oka [@Oka:1983sp]. In the following, we make a closer comparison with these works and, then, present results for the contribution of various PNC two-body currents considered for the first time. Comparison with Oka’s work \[sub:CompOka\] ------------------------------------------ The major difference comes from the pion sector. In Ref. [@Khriplovich:2000mb], where the scattering wave functions are obtained from the zero-range approximation and the deuteron is purely a $^{3}S_{1}$ state, a simple angular momentum consideration leads to a null contribution from pions. Our result shows that the more complex nuclear dynamics has only small corrections, so the asymmetry is not sensitive to $h_{\pi}^{1}$. However, it is not the case at all in Ref. [@Oka:1983sp]: the pion exchange dominates the asymmetry with the coefficient $c_{1}$ being one or two orders of magnitude larger than our result. This discrepancy could be illustrated by considering a case where $\omega_{\gamma}$ is 10 MeV above the threshold. In the central column of Table \[cap:compare Oka’s\], we list the pertinent PNC responses due to the pion exchange among the 5 dominant exit channels. In the right column, we simulate what the outcome will be if the analytical results of Eqs. (5a–5g) in Ref. [@Oka:1983sp] are used, *i.e.* with different factors involving $\mu_{\ssst{S}}$ and no parity admixture of $^{3}P_{1}$ state as mentioned in Sec. \[sec:formalism\]. Comparing the totals from both columns, one immediately observes the simulated result is bigger by an order of magnitude. More inspection shows that, while the changes of the $\mu_{\ssst{S}}$ factors do alter each response somewhat, the major difference depends on whether the big cancellation from the $^{3}P_{1}$ admixture is included or not. By adding contributions from other sub-leading channels, the total will be further downed by a factor of 2.5. Thus the overall difference is about a factor of 30. Transitions Eqs. (\[eq:comp-i\]–\[eq:comp-f\]) Eqs. (5a–5h) in Ref. [@Oka:1983sp] --------------------------------------------------- ------------------------------------ ------------------------------------ $^{3}P_{0}\leftrightarrow\tilde{\mathcal{D}}$ 0.449 -0.142 $^{3}P_{1}\leftrightarrow\tilde{\mathcal{D}}$ -3.217 -4.383 $\widetilde{^{3}P_{1}}\leftrightarrow\mathcal{D}$ 3.942 not considered $^{3}P_{2}\leftrightarrow\tilde{\mathcal{D}}$ -1.231 0.389 $\widetilde{^{3}P_{2}}\leftrightarrow\mathcal{D}$ -0.142 0.045 $^{3}F_{2}\leftrightarrow\tilde{\mathcal{D}}$ -0.151 0.048 $\widetilde{^{3}F_{2}}\leftrightarrow\mathcal{D}$ -0.019 0.006 Total -0.371 -4.037 : The dominant PNC responses due to the pion exchange for $\omega_{\gamma}$ 10 MeV above the threshold (in units of $10^{-5}\times h_{\pi}^{1}$). The central column is calculated by Eqs. (\[eq:comp-i\]–\[eq:comp-f\]), while the right column by Eqs. (5a–5h) in Ref. [@Oka:1983sp]. The symbol $\mathcal{D}$ denotes the deuteron state. \[cap:compare Oka’s\] **Comparison with Khriplovich and Korkin’s work \[sub:CompKK\]** ---------------------------------------------------------------- The vanishing of the $\pi$-exchange contribution in Khriplovich and Korkin’s work [@Khriplovich:2000mb] supposes that the $E1$ transitions from the deuteron state to the different scattering states, $^{3}P_{0}$, $^{3}P_{1}$ and $^{3}P_{2}$, are the same, which implies that one neglects both the tensor and spin-orbit components of the strong interaction. As these parts of the force have large effects in some cases, it is important to determine how the above vanishing is affected when a more realistic description of the interaction is used. We first notice that the isoscalar magnetic operator, $\muS\,\bm S+\bm L/2$, can be written as $\muS\,\bm J+(1/2-\muS)\bm L$. As the operator $\bm J$ conserves the total angular momentum, it follows that the $E1$ transitions from the deuteron state to the $^{3}P_{0}$ and $^{3}P_{2}$ states will be proportional to $\muS-1/2$, in agreement with Eqs. (\[eq:comp-ia\]) and (\[eq:comp-f\]). A similar result holds for the $^{3}P_{1}$ state. For this transition, one has to take into account that the $\bm J$ operator connects states that are orthogonal to each other, including the case where they contain some parity admixture. This unusual but interesting result was originally suggested by a similar result obtained by Khriplovich and Korkin for the $^{1}S_{0}$ and $^{3}P_{0}$ states [@Khriplovich:2000mb]. They used it later on for the $\pi$-exchange contribution on the suggestion of one the present authors. Taking this property into account, one can check that the different $\muS$-dependent terms in Eq. (\[eq:comp-ib\]) combine so that the quantity, $\muS-1/2$, can be factored out. This explains the cancellation of the two largest contributions in Table \[cap:compare Oka’s\], $3.942$ and $-3.217$, approximately proportional to $2\,\muS=1.76$ and $-(\muS+1/2)=-1.38$. Further cancellation is obtained when one considers the sum of the $\pi$-exchange contributions to the asymmetry $A_{\gamma}$ corresponding to the different $P$ states. Taking into account the remark made in the previous paragraph, it can be checked that contributions from Eqs. (\[eq:comp-ia\]), (\[eq:comp-ib\]) and (\[eq:comp-f\]) are proportional to 2, 3 and $-5$ and 4, $-3$, and $-1$ for the $^{3}S_{1}$ and $^{3}D_{1}$ deuteron components respectively (assuming that the $^{3}P$ wave functions are the same). As can be seen in Table \[cap:compare Oka’s\], the dominant contributions, 0.449, 0.725 $(=3.942-3.217)$ and $-1.231$ are not far from the relative ratios 2, 3 and $-5$, expected for the $^{3}S_{1}$ deuteron component. Possible departures can be ascribed in first place to the $^{3}D_{1}$ deuteron component. The above cancellation calls for an explanation deeper than the one consisting in the verification that the algebraic sum of different contributions cancels. An argument could be the following. In the conditions where the cancellation takes place (same interaction in the $^{3}P$ states in particular), a closure approximation involving spin and angular orbital momentum degrees of freedom can be used to simplify the writing of the PNC part of the response function that appears at the numerator of Eq. (\[eq:asym\]). Keeping only the factors of interest here, the interference term of $E1$ and $M1$ matrix elements can be successively transformed as follows $$\begin{aligned} \delta R & \propto & \sum_{M}\bra{J_{i}}\,\hat{r}^{i}\,(\muS-\tfrac12)\, L^{j}\,\left(\delta^{ij}-\hat{q}^{i}\,\hat{q}^{j}\right)\widetilde{{\ket{J_{i}}}}\nonumber \\ & \propto & \sum_{M}\Big[\bra{^{3}S_{1}}U_{d}(^{3}S_{1})+\frac{U_{d}(^{3}D_{1})}{\sqrt{2}}\,\left(3\,(\bm S\!\cdot\!\hat{r})^{2}-S^{2}\right)\,\Big]\nonumber \\ & & \hspace{1cm}\times\:\hat{r}^{i}\, L^{j}\,\left(\delta^{ij}-\hat{q}^{i}\,\hat{q}^{j}\right)\Big[\bm S\cdot\hat{r}\,\ket{^{3}S_{1}}\Big]\nonumber \\ & \propto & {\textrm{Tr}}\left(\Big[U_{d}(^{3}S_{1})+\frac{U_{d}(^{3}D_{1})}{\sqrt{2}}\,\left(3\,(\bm S\!\cdot\!\hat{r})^{2}-S^{2}\right)\,\Big]\,\bm S\!\cdot\!\hat{r}\right)\nonumber \\ & = & 0\,.\label{eq:cancellation}\end{aligned}$$ The first line stems from retaining the isoscalar part of the magnetic operator proportional to $(\muS-1/2)\bm L$ (it is reminded that the $\bm J$ part does not contribute). The next line is obtained by expressing the PC and PNC parts of the deuteron wave function as some operator acting on a pure $|^{3}S_{1}\rangle$ state. Once this transformation is made, it is possible to replace the summation over the deuteron angular momentum components, $M$, by the spin ones, $m_{s}$, which is accounted for at the third line. The last line then follows from the fact that the trace of the spin operator, $\bm S$, possibly combined with a $\Delta S=2$ one, vanishes. A result similar to the above one can be obtained for some contributions involving MECs. It is however noticed that some corrections involving the spin-orbit force, or spin-dependent terms in the E1 transition operator, which both contain an extra $\bm S$ factor in the above equation, could lead to a non-zero trace and therefore to a relatively large correction. Of course, the above cancellation relies on the fact that no polarization of the initial or final state is considered. Had we looked at an observable involving such a polarization, like the asymmetry in the capture of polarized thermal neutrons by protons, the result will be quite different. As is well known, this observable is dominated by the $\pi$-exchange contribution [@Danilov:1965]. **Contributions of PNC ECs \[sub:PNC-ECs\]** -------------------------------------------- In Section \[sec:formalism\], the contributions of PNC ECs were summarized in two additional PNC-induced form factors, $\tilde{F}_{E1_{5}}^{(S')}$ and $\tilde{F}_{M1_{5}}^{(2')}$. Now, we estimate these contributions by considering only the dominant channels $^{1}S_{0}$, $^{3}P_{0}$, $^{3}P_{1}$ and $^{3}P_{2}$–$^{3}F_{2}$. As $E1_{5}$ connects states of same parity, only $^{1}S_{0}$ is allowed; therefore, $\tilde{F}_{E1_{5}}^{(S')}$ plays a more important role for $A_{\gamma}$ near the threshold. On the other hand, $M1_{5}$ connects states of opposite parity, which requires the other four channels, so $\tilde{F}_{M1_{5}}^{(2')}$ has more impact on $A_{\gamma}$ at higher energies. The full set of PNC ECs which is consistent with the DDH potential was derived in [@Liu:2003au], Eqs. (17–24). The whole evaluation is straightforward, however tedious, so we defer all the analytical expressions in Appendix \[sec:appendix-PNC-ECs\] and only quote the numerical results here. With the same parametrization as Eq. (\[eq:A exp\]), the additional contributions to the asymmetry by PNC ECs, via $E1_{5}$ and $M1_{5}$ respectively, are $$\begin{aligned} A_{\gamma}(\tilde{F}_{E1_{5}}^{(S')}) & = & c_{2}^{(S')}\, h_{\rho}^{0}+c_{4}^{(S')}\, h_{\rho}^{2}\,,\label{eq:E1-PNC}\\ A_{\gamma}(\tilde{F}_{M1_{5}}^{(2')}) & = & c_{1}^{(2')}\, h_{\pi}^{1}+c_{2}^{(2')}\, h_{\rho}^{0}+c_{3}^{(2')}\, h_{\rho}^{1}\nonumber \\ & & +c_{4}^{(2')}\, h_{\rho}^{2}+c_{6}^{(2')}\, h_{\omega}^{1}\,.\label{eq:M1-PNC}\end{aligned}$$ The detailed energy-dependence of each coefficient is shown in Fig. \[fig:pncecs\]. The dominance of $\tilde{F}_{E1_{5}}^{(S')}$ near the threshold and $\tilde{F}_{M1_{5}}^{(2')}$ at higher energies could be readily observed in these plots. We discuss their significances to the total asymmetry in the following. For the case where the photon energy is 0.01 MeV above the threshold, only $c_{2}^{(S')}$ and $c_{4}^{(S')}$ are substantial. The former coefficient is about 20% of $c_{2}$, while the latter one is only 2% of $c_{4}$. By using the DDH best values, these contributions give an asymmetry about 1.4$\times10^{-9}$, which is a 6% correction. This is typically the order of magnitude one could expect from the exchange effects. As the energy gets larger, while the coefficients $c_{2}^{(S')}$ and $c_{4}^{(S')}$ keep stable, the coefficients associated with $M1_{5}$ matrix elements grow linearly, roughly. The fastest growing one is $c_{1}^{(2')}$ because the long-ranged pion-exchange dominates the matrix elements. Comparatively, $c_{2}^{(2')}$ has a smaller slope due to less overlap between the effective ranges pertinent to the deuteron wave function and the $\rho$-exchange. For the case where the photon energy is 10 MeV above the threshold, $c_{1}^{(2')}$, $c_{2}^{(2')}$, and $c_{2}^{(S')}$ are substantial. The first coefficient is about 50% of $c_{1}$, and the latter two combined is about 16% of $c_{2}$. The extremely large correction to $c_{1}$ can be simply explained. The cancellation which affects the single-particle contribution (see Eq. (\[eq:cancellation\])) does not apply to the two-body one. By using the DDH best values, all contributions due to PNC ECs give an asymmetry about 3.7$\times10^{-11}$, which is a 5% correction. The reason why large effects from individual meson exchanges lead to an overall small correction is due to the cancellation between pion and heavy-meson exchanges: the DDH best values have opposite signs for the pion and heavy-meson couplings. This conclusion however depends on the sign we assumed for the $g_{\rho\pi\gamma}$ coupling. Conclusion \[sec:conclusion\] ============================= The present work has been motivated by various aspects of the PNC asymmetry $A_{\gamma}$ in the deuteron photodisintegration, especially in the few-MeV photon-energy range. A first work addressing this energy domain [@Oka:1983sp] showed that the process could provide information on the PNC $\pi NN$ coupling constant, $h_{\pi}^{1}$, which allows one to check results from other processes involving this coupling. A later work [@Khriplovich:2000mb], rather schematic, concluded that this contribution could be largely suppressed. Between these two extreme limits, the question arises of what this contribution could be when a realistic description is made, including in particular the tensor and spin-orbit components of the $NN$ interaction. At the first sight, a sizable PNC $\pi$-exchange contribution could arise if one assumes tensor-force effects of about 15% for each partial contribution and no cancellation. The complete calculation shows that the $\pi$-exchange contribution remains strongly suppressed after improving upon the schematic model. Beyond making this observation, a genuine explanation should therefore be found. When considering the asymmetry $A_{\gamma}$, an average is made over the spins of initial and final states. Terms in the interference effects of electric and magnetic transitions, whose spin dependence averages to a non-zero value, are expected to produce a sizable contribution. This discards the $\pi$-exchange contribution which involves a linear dependence on the spin operator $\bm S$ and tensor-force effects which involve the product of spin operators of order 1 and 2. The argument applies to MECs too. A different conclusion would hold for an observable implying a spin polarization of the initial or final state. It thus appears some similarity between the relative role of various contributions here and that one emphasized by Danilov for the inverse process at thermal energies: the circular polarization of photons $P_{\gamma}$ (equivalent to $A_{\gamma}$ here) is mainly dependent on the PNC isoscalar and isotensor contributions while the asymmetry of the photon emission with respect to the neutron polarization depends on the $\pi$-exchange contribution. As the $\pi$-exchange contribution to the asymmetry $A_{\gamma}$ turns out to have a minor role, we can concentrate on the vector-meson ones. At the low energies considered here, it is expected that these contributions depend on two combinations of parameters entering the description of the PNC (and PC) $NN$ interaction. They are the zero-energy neutron-proton scattering amplitudes in the $T=0$ and $T=1$ channels, $\lambda_{t}$ and $\lambda_{s}$. In terms of these quantities introduced by Danilov [@Danilov:1965] (see also later works by Missimer [@Missimer:1976wb], Desplanques and Missimer [@Desplanques:1978mt], Holstein [@Holstein]) the discussion could be simpler. The asymmetry is found to vary between $$A_{\gamma}=0.70\,\mN\,\lambda_{t}-0.17\,\mN\,\lambda_{s}\;\;{\textrm{at \; threshold}}$$ and $$A_{\gamma}=-0.037\,\mN\,\lambda_{t}+0.022\,\mN\,\lambda_{s}\;\;{\textrm{at}}\;\omega_{\gamma}=12{\textrm{ MeV}},$$ thus evidencing a change in sign which occurs around $\omega_{\gamma}=5.5\;{\textrm{MeV}}$ for both amplitudes. Depending on low-energy properties and, thus, on the best known properties of the strong interaction, the place where the cancellation of $A_{\gamma}$ occurs sounds to be well established. It roughly agrees with what can be inferred from the analytic work by Khriplovich and Korkin [@Khriplovich:2000mb]. Not much sensitivity to PNC ECs is found. An experiment should therefore aim at a measurement at energies significantly different, either below or above. The goal for studying PNC effects is to get information on the hadronic physics entering the PNC $NN$ interaction. This supposes that one can disentangle the different contributions to each process. We notice that the combination of parameters $\lambda_{t}$ and $\lambda_{s}$ appearing in the expression of $A_{\gamma}$ is orthogonal to that one determining PNC effects in most other processes, especially in medium and heavy nuclei. The study of the present process is therefore quite useful. Another observation, which is not totally independent of the previous one, concerns the isotensor contribution. This one is especially favored in the present process while it is generally suppressed in processes involving a roughly equal number of protons and neutrons with either spin [@Desplanques:1998ak]. The present process is therefore among the best ones to get information on the isotensor $\rho NN$ coupling constant. We however stress that this supposes the isoscalar parts could be constrained well by other processes. In a meson-exchange model of the PNC interaction, these ones are represented by the isoscalar $\rho NN$ and $\omega NN$ coupling constants. One could add that the relative sign of these two contributions is the same, in a large range of the photon energy ($\omega_{\gamma}\geq3\;$MeV), as in many other processes. It however differs at small photon energies where the asymmetry involves a combination of the various isoscalar and isotensor couplings that is little constrained by other processes. This explains that expectations of $A_{\gamma}$ up to $10^{-7}$ near threshold could be suggested in recent works on the basis of a phenomenological analysis [@Desplanques:1998ak; @Khriplovich:2000mb; @Schi-int]. Measuring this asymmetry could therefore be quite useful to determine a poorly known component of PNC $NN$ interactions. On the theoretical side, the present work should be completed by the contribution of further parity-conserving exchange currents, but also by higher $1/m_{N}$-order corrections from the single-particle current and, consistently, from both PC and PNC exchange currents [@Friar:1983wd]. Though they are not expected to change the main conclusions reached here, they could be required to obtain from experiment a more accurate information on PNC $NN$ forces. C.-P.L. would like to thank R. Schiavilla, M. Fujiwara, and A.I. Titov for useful disussions. C.H.H. gratefully acknowledges the hospitality of the Laboratoire de Physique Subatomique et de Cosmologie, where part of this work was performed. Work of C.H.H. is partially supported by Korea Research Foundation (Grant No. KRF-2003-070-C00015). Non-vanishing Matrix Elements of PNC ECs for Dominant Transitions \[sec:appendix-PNC-ECs\] ========================================================================================== In this section, we summarize the analytical expressions of the non-zero $\tilde{F}_{E1_{5}}^{(S')}$ and $\tilde{F}_{M1_{5}}^{(2')}$ for the five dominant channels which lead to the numerical results in Section \[sub:PNC-ECs\]. $\tilde{F}_{E1_{5}}^{(S')}$ --------------------------- As discussed in Section \[sec:formalism\], an exchange charge at $O(1)$ should contribute to this form factor. According to Ref. [@Liu:2003au], the $\rho$-exchange does generate one:$$\rho_{mesonic}^{\rho}(\bm x;\bm r_{1},\bm r_{2})=2\, e\, g_{\rho\ssst{NN}}\left(h_{\rho}^{0}-\frac{h_{\rho}^{2}}{2\sqrt{6}}\right)(\bm\tau_{1}\times\bm\tau_{2})^{z}(\bm\sigma_{1}-\bm\sigma_{2})\cdot\bm\nabla_{x}\Big(f_{\rho}(r_{x1})f_{\rho}(r_{x2})\Big)\,,$$ with $f_{\ssst{X}}(r)=\exp(-m_{\ssst{X}}\, r)/(4\,\pi\, r)$ and $r_{xi}=|\bm x-\bm r_{i}|$. The $^{1}S_{0}$ state is the only open exit channel and it gives$$\langle E1_{5}^{(S')}\rangle=8\,\frac{g_{\rho\ssst{NN}}}{m_{\rho}}\left(h_{\rho}^{0}-\frac{h_{\rho}^{2}}{2\sqrt{6}}\right)\bra{^{1}S_{0}}r\, f_{\rho}(r)\ket{^{3}S_{1}}_{d}\,,$$ where $\bra{f}F(r)\ket{i}_{d}$ denotes the radial integral $\int dr\, U^{*}(f)\, F(r)\, U_{d}(i)$ and the subscript “$d$” refers to the deuteron state. $\tilde{F}_{M1_{5}}^{(2')}$ --------------------------- As the four allowed exit channels $^{3}P_{0}$, $^{3}P_{1}$ and $^{3}P_{2}$–$^{3}F_{2}$ are spin- and isospin-triplet, the non-vanishing PNC ECs, which satisfy the spin and isospin selections rules, are $$\begin{aligned} \bm j_{pair}^{\rho}(\bm x;\bm r_{1},\bm r_{2}) & = & \frac{e\, g_{\rho\ssst{NN}}}{4\mN}\, h_{\rho}^{1}\, f_{\rho}(r)(\tau_{1}^{z}-\tau_{2}^{z})(\bm\sigma_{1}+\bm\sigma_{2})\Big((1+\tau_{1}^{z})\delta^{(3)}(\bm x-\bm r_{1})\Big)+(1\leftrightarrow2)\,,\\ \bm j_{pair}^{\omega}(\bm x;\bm r_{1},\bm r_{2}) & = & \frac{-e\, g_{\omega\ssst{NN}}}{4\mN}\, h_{\omega}^{1}\, f_{\omega}(r)(\tau_{1}^{z}-\tau_{2}^{z})(\bm\sigma_{1}+\bm\sigma_{2})\Big((1+\tau_{1}^{z})\delta^{(3)}(\bm x-\bm r_{1})\Big)+(1\leftrightarrow2)\,,\\ \bm j_{mesonic}^{\rho}(\bm x;\bm r_{1},\bm r_{2}) & = & \frac{-e\, g_{\rho\ssst{NN}}}{\mN}\left(h_{\rho}^{0}-\frac{h_{\rho}^{2}}{2\sqrt{6}}\right)(\bm\tau_{1}\times\bm\tau_{2})^{z}\nabla_{x}^{a}\Big(i\left\{ \nabla_{1}^{a}\bm\sigma_{2}+\sigma_{1}^{a}\bm\nabla_{2},\, f_{\rho}(r_{x1})\, f_{\rho}(r_{x2})\right\} \nonumber \\ & & -\muV\left[(\bm\sigma_{1}\times\bm\nabla_{1})^{a}\bm\sigma_{2}+\sigma_{1}^{a}\bm\sigma_{2}\times\bm\nabla_{2},\, f_{\rho}(r_{x1})\, f_{\rho}(r_{x2})\right]\Big)+(1\leftrightarrow2)\,,\\ \bm j_{mesonic}^{\rho\pi}(\bm x;\bm r_{1},\bm r_{2}) & = & \frac{-e\, g_{\rho\ssst{NN}}\, g_{\rho\pi\gamma}}{\sqrt{2}\, m_{\rho}}\, h_{\pi}^{1}(\bm\tau_{1}\times\bm\tau_{2})^{z}(\bm\nabla_{1}\times\bm\nabla_{2})\Big(f_{\rho}(r_{x1})f_{\pi}(r_{x2})\Big)+(1\leftrightarrow2)\,.\label{eq:rhopiMesonic}\end{aligned}$$ Note that one additional strong meson-nucleon coupling constant, $g_{\rho\pi\gamma}$, appears in Eq. (\[eq:rhopiMesonic\]). This could be constrained by the $\rho\rightarrow\pi+\gamma$ data. For the numerical calculation, we quote the number $g_{\rho\pi\gamma}=0.585$ as given in Ref. [@Truhlik:2000yx]. The matrix element $\langle M1_{5}^{(2')}\rangle$ can be written as a sum of the contributions from each EC as$$\langle M1_{5}^{(2')}\rangle=\frac{1}{\mN}\left(g_{\rho\ssst{NN}}\, h_{\rho}^{1}\, X_{1}+g_{\omega\ssst{NN}}\, h_{\omega}^{1}\, X_{2}+g_{\rho\ssst{NN}}\,\left(h_{\rho}^{0}-\frac{h_{\rho}^{2}}{2\sqrt{6}}\right)X_{3}\right)+\frac{1}{m_{\rho}}\,\grhoNN\, g_{\rho\pi\gamma}\, h_{\pi}^{1}\, X_{4}\,,$$ and for each exit channel, the quantities $X_{1,2,3,4}$ are 1\. $^{3}P_{0}$$$\begin{aligned} X_{1} & = & -\frac{2}{3}\left(\bra{^{3}P_{0}}r\, f_{\rho}(r)\ket{^{3}S_{1}}_{d}+\frac{1}{\sqrt{2}}\,\bra{^{3}P_{0}}r\, f_{\rho}(r)\ket{^{3}D_{1}}_{d}\right)\,,\\ X_{2} & = & \frac{2}{3}\left(\bra{^{3}P_{0}}r\, f_{\omega}(r)\ket{^{3}S_{1}}_{d}+\frac{1}{\sqrt{2}}\,\bra{^{3}P_{0}}r\, f_{\omega}(r)\ket{^{3}D_{1}}_{d}\right)\,,\\ X_{3} & = & -\frac{8}{3}\left((1+2\muV)\,\bra{^{3}P_{0}}r\, f_{\rho}(r)\ket{^{3}S_{1}}_{d}+\frac{1}{\sqrt{2}}\,(1-\muV)\,\bra{^{3}P_{0}}r\, f_{\rho}(r)\ket{^{3}D_{1}}_{d}\right.\nonumber \\ & & \left.\hspace{0.7cm}-\frac{2}{m_{\rho}}\,\bra{^{3}P_{0}}r\, f_{\rho}(r)\ket{^{3}S_{1}^{(+)}}_{d}-\frac{\sqrt{2}}{m_{\rho}}\,\bra{^{3}P_{0}}r\, f_{\rho}(r)\ket{^{3}D_{1}^{(-)}}_{d}\right),\\ X_{4} & = & \frac{4\sqrt{2}}{3\,(m_{\rho}^{2}-m_{\pi}^{2})}\left(\bra{^{3}P_{0}}f_{\pi\rho}^{\,'}(r)\ket{^{3}S_{1}}_{d}-\sqrt{2}\,\bra{^{3}P_{0}}f_{\pi\rho}^{\,'}(r)\ket{^{3}D_{1}}_{d}\right)\,;\end{aligned}$$ 2\. $^{3}P_{1}$ $$\begin{aligned} X_{1} & = & \frac{1}{\sqrt{3}}\left(\bra{^{3}P_{1}}r\, f_{\rho}(r)\ket{^{3}S_{1}}_{d}-\sqrt{2}\,\bra{^{3}P_{1}}r\, f_{\rho}(r)\ket{^{3}D_{1}}_{d}\right)\,,\\ X_{2} & = & -\frac{1}{\sqrt{3}}\left(\bra{^{3}P_{1}}r\, f_{\omega}(r)\ket{^{3}S_{1}}_{d}-\sqrt{2}\,\bra{^{3}P_{1}}r\, f_{\omega}(r)\ket{^{3}D_{1}}_{d}\right)\,,\\ X_{3} & = & \frac{4}{\sqrt{3}}\bigg((1-\muV)\,\bra{^{3}P_{1}}r\, f_{\rho}(r)\ket{^{3}S_{1}}_{d}-\sqrt{2}\,(1-\muV)\,\bra{^{3}P_{1}}r\, f_{\rho}(r)\ket{^{3}D_{1}}_{d}\nonumber \\ & & \hspace{0.7cm}-\frac{2}{m_{\rho}}\,\bra{^{3}P_{1}}r\, f_{\rho}(r)\ket{^{3}S_{1}^{(+)}}_{d}+\frac{2\sqrt{2}}{m_{\rho}}\,\bra{^{3}P_{1}}r\, f_{\rho}(r)\ket{^{3}D_{1}^{(-)}}_{d}\bigg),\\ X_{4} & = & -\frac{4\sqrt{2}}{\sqrt{3}\,(m_{\rho}^{2}-m_{\pi}^{2})}\left(\bra{^{3}P_{1}}f_{\pi\rho}^{\,'}(r)\ket{^{3}S_{1}}_{d}+\frac{1}{\sqrt{2}}\,\bra{^{3}P_{1}}f_{\pi\rho}^{\,'}(r)\ket{^{3}D_{1}}_{d}\right)\,;\end{aligned}$$ 3\. $^{3}P_{2}$–$^{3}F_{2}$ $$\begin{aligned} X & = & \frac{\sqrt{5}}{3}\left(\bra{^{3}P_{2}}r\, f_{\rho}(r)\ket{^{3}S_{1}}_{d}-\frac{2\sqrt{2}}{5}\,\bra{^{3}P_{2}}r\, f_{\rho}(r)\ket{^{3}D_{1}}_{d}-\frac{3\sqrt{3}}{5}\,\bra{^{3}F_{2}}r\, f_{\rho}(r)\ket{^{3}D_{1}}_{d}\right)\,,\\ X_{2} & = & -\frac{\sqrt{5}}{3}\left(\bra{^{3}P_{2}}r\, f_{\omega}(r)\ket{^{3}S_{1}}_{d}\,-\frac{2\sqrt{2}}{5}\bra{^{3}P_{2}}r\, f_{\omega}(r)\ket{^{3}D_{1}}_{d}-\frac{3\sqrt{3}}{5}\,\bra{^{3}F_{2}}r\, f_{\omega}(r)\ket{^{3}D_{1}}_{d}\right)\,,\\ X_{3} & = & \frac{4\sqrt{5}}{3}\left((1-\muV)\,\bra{^{3}P_{2}}r\, f_{\rho}(r)\ket{^{3}S_{1}}_{d}-\frac{2\sqrt{2}}{5}\,(1-4\muV)\,\bra{^{3}P_{2}}r\, f_{\rho}(r)\ket{^{3}D_{1}}_{d}\right.\nonumber \\ & & \hspace{1.0cm}-\frac{2}{m_{\rho}}\,\bra{^{3}P_{2}}r\, f_{\rho}(r)\ket{^{3}S_{1}^{(+)}}_{d}+\frac{4\sqrt{2}}{5\, m_{\rho}}\,\bra{^{3}P_{2}}r\, f_{\rho}(r)\ket{^{3}D_{1}^{(-)}}_{d}\nonumber \\ & & \left.\hspace{1.0cm}-\frac{3\sqrt{3}}{5}\,(1+\muV)\,\bra{^{3}F_{2}}r\, f_{\rho}(r)\ket{^{3}D_{1}}_{d}+\frac{6\sqrt{3}}{5\, m_{\rho}}\,\bra{^{3}F_{2}}r\, f_{\rho}(r)\ket{^{3}D_{1}^{(+)}}_{d}\right),\\ X_{4} & = & \frac{4\sqrt{10}}{3\,(m_{\rho}^{2}-m_{\pi}^{2})}\left(\bra{^{3}P_{2}}f_{\pi\rho}^{\,'}(r)\ket{^{3}S_{1}}_{d}-\frac{1}{5\sqrt{2}}\,\bra{^{3}P_{2}}f_{\pi\rho}^{\,'}(r)\ket{^{3}D_{1}}_{d}+\frac{3\sqrt{3}}{5}\,\bra{^{3}F_{2}}f_{\pi\rho}^{\,'}(r)\ket{^{3}D_{1}}_{d}\right)\,,\end{aligned}$$ where $\ket{^{2S+1}L_{J}^{(+)}}\equiv\left(\frac{d}{dr}-\frac{L+1}{r}\right)\ket{^{2S+1}L_{J}}$, $\ket{^{2S+1}L_{J}^{(-)}}\equiv\left(\frac{d}{dr}+\frac{L}{r}\right)\ket{^{2S+1}L_{J}}$, and $f_{\pi\rho}^{\,'}(r)\equiv\frac{d}{dr}\left(f_{\pi}(r)-f_{\rho}(r)\right)$. [^1]: We also note that unlike our notation, $\mu_{\ssst{S,V}}$ is used to denote the anomalous magnetic moments in Ref. [@Oka:1983sp].

You are here The state of the U.S. election system Submitted by gbain on Mon, 10/29/2012 - 13:13 When it comes to the integrity and accuracy of voting systems in the United States, the good news is that widespread technological upgrades have largely eliminated the voting-machine problems that were so evident when Florida’s disputed recount determined the 2000 presidential election.The bad news is that some of those improvements in accuracy could be undermined by increases in early voting through the mail, which is turning out to be a relatively low-accuracy method of voting, according to a new research report released by MIT and the California Institute of Technology.“A lot of changes over the last decade have made voting in America better,” says Charles Stewart III, the Kenan Sahin Distinguished Professor of Political Science at MIT, who co-authored the new report with five colleagues at four universities. “The possibility of a [situation like Florida’s 2000 election] is much lower now than it was 12 years ago.”However, Stewart adds, “We have possibly gotten way ahead of ourselves in encouraging people to vote by mail. It’s pretty clear that the improvement we’ve gotten by having better voting machines in the precincts may be given back by having more and more people voting at home.”

Dr. med. Sommer II Dr. med. Sommer II is an East German drama film. It was released in 1970 and was directed by Lothar Warneke. External links Category:1970 films Category:1970s drama films Category:German drama films Category:East German films Category:German-language films Category:Films directed by Lothar Warneke Category:Hospital films Category:Films whose director won the Heinrich Greif Prize

name = 'HDF5' version = '1.10.2' homepage = 'https://portal.hdfgroup.org/display/support' description = """HDF5 is a data model, library, and file format for storing and managing data. It supports an unlimited variety of datatypes, and is designed for flexible and efficient I/O and for high volume and complex data.""" toolchain = {'name': 'PGI', 'version': '18.4-GCC-6.4.0-2.28'} toolchainopts = {'pic': True} source_urls = ['https://support.hdfgroup.org/ftp/HDF5/releases/hdf5-%(version_major_minor)s/hdf5-%(version)s/src'] sources = [SOURCELOWER_TAR_GZ] checksums = [ 'bfec1be8c366965a99812cf02ddc97e4b708c1754fccba5414d4adccdc073866', # hdf5-1.10.2.tar.gz ] # Add -noswitcherror to make PGI compiler ignore the unknown compiler option -pthread preconfigopts = 'export CXX="$CXX -noswitcherror" && ' dependencies = [ ('zlib', '1.2.11'), ('Szip', '2.1.1'), ] moduleclass = 'data'

Diagnosis of spatiotemporal chaos in wave envelopes of a nematic electroconvection pattern. In this paper we report and analyze complex spatiotemporal dynamics recorded in electroconvection in the nematic liquid crystal I52, driven by an ac voltage slightly above the onset value. The instability mechanism creating the pattern is an oscillatory (Hopf) instability, giving rise to two pairs of counterpropagating rolls traveling in oblique directions relative to the unperturbed director axis. If a system of nonlinear partial differential equations shows the same set of unstable modes, the pattern above the onset is represented in a weakly nonlinear analysis as a superposition of the traveling rolls in terms of wave envelopes varying slowly in space and time. Motivated by this procedure, we extract slowly varying envelopes from the space-time data of the pattern, using a four-wave demodulation based on Fourier analysis. In order to characterize the spatiotemporal dynamics, we apply a variety of diagnostic methods to the envelopes, including the calculation of mean intensities and correlation lengths, global and local Karhunen-Loève decompositions in Fourier space and physical space, the location of holes, the identification of coherent vertical structures, and estimates of Lyapunov exponents. The results of this analysis provide strong evidence that our pattern exhibits extensive spatiotemporal chaos. One of its main characteristics is the presence of coherent structures of low and high intensities extended in the vertical (parallel to the director) direction.

prob of sequence poyb? 2/3003 Calculate prob of sequence yys when three letters picked without replacement from mmsmyyy. 1/35 Two letters picked without replacement from {a: 4, f: 16}. What is prob of sequence af? 16/95 What is prob of sequence smms when four letters picked without replacement from dsmmdwsss? 1/126 What is prob of sequence nin when three letters picked without replacement from iniiiiiniipiiininnh? 40/969 Two letters picked without replacement from {b: 1, k: 1, t: 2, w: 4, p: 1, g: 3}. Give prob of sequence kt. 1/66 Four letters picked without replacement from xditxoutdduuuudud. Give prob of sequence uudo. 5/1904 Calculate prob of sequence fe when two letters picked without replacement from gguxfgghfegxuegfgfg. 4/171 Two letters picked without replacement from onononoooonnohn. Give prob of sequence nh. 1/35 Two letters picked without replacement from effefffffffff. Give prob of sequence ef. 11/78 Calculate prob of sequence hiz when three letters picked without replacement from {n: 1, z: 1, h: 4, i: 2}. 1/42 What is prob of sequence vv when two letters picked without replacement from vvvvvvvwvvqvvv? 66/91 Four letters picked without replacement from kkkan. Give prob of sequence aaaa. 0 Four letters picked without replacement from {p: 12, e: 1}. Give prob of sequence pppp. 9/13 What is prob of sequence hh when two letters picked without replacement from {h: 9}? 1 Two letters picked without replacement from {e: 2, q: 5, u: 8, v: 2}. Give prob of sequence qq. 5/68 What is prob of sequence hekk when four letters picked without replacement from hekfekkk? 1/70 What is prob of sequence jxzj when four letters picked without replacement from xjajz? 1/60 Three letters picked without replacement from {n: 4}. Give prob of sequence nnn. 1 Three letters picked without replacement from {o: 2, l: 3, g: 1, f: 3, w: 4, j: 3}. Give prob of sequence wjg. 1/280 What is prob of sequence zs when two letters picked without replacement from {u: 3, k: 3, a: 1, z: 3, c: 1, s: 2}? 1/26 Three letters picked without replacement from bbinicbukcun. Give prob of sequence ikb. 1/220 Calculate prob of sequence rbv when three letters picked without replacement from {b: 1, h: 1, y: 1, r: 1, v: 1}. 1/60 Three letters picked without replacement from {y: 3, d: 1, v: 1}. Give prob of sequence dyv. 1/20 Calculate prob of sequence kjjr when four letters picked without replacement from kxxkzrkqxzjj. 1/1980 Four letters picked without replacement from {a: 16, t: 4}. What is prob of sequence attt? 16/4845 What is prob of sequence nih when three letters picked without replacement from {n: 2, f: 1, i: 1, h: 2}? 1/30 Three letters picked without replacement from {m: 10, l: 4}. What is prob of sequence lml? 5/91 Calculate prob of sequence ub when two letters picked without replacement from bfckbfkfbbkkku. 2/91 Three letters picked without replacement from {m: 2, i: 5, g: 6}. Give prob of sequence mii. 10/429 Two letters picked without replacement from {h: 1, u: 1, w: 1, b: 1, c: 5}. What is prob of sequence ub? 1/72 Three letters picked without replacement from bbzzbb. What is prob of sequence zbz? 1/15 Three letters picked without replacement from cpfhhcc. What is prob of sequence phh? 1/105 Calculate prob of sequence ia when two letters picked without replacement from qiqassqsraqhsa. 3/182 Two letters picked without replacement from {g: 1, j: 3}. Give prob of sequence jj. 1/2 Two letters picked without replacement from {g: 1, h: 6, m: 1, q: 5, a: 6}. Give prob of sequence hg. 1/57 What is prob of sequence wg when two letters picked without replacement from {w: 13, g: 3}? 13/80 Calculate prob of sequence zpzp when four letters picked without replacement from ppzppzpzppzpq. 28/715 Two letters picked without replacement from {u: 3, m: 1, t: 3, x: 1, d: 1, y: 2}. Give prob of sequence mt. 3/110 Four letters picked without replacement from dihihiiok. What is prob of sequence ikhd? 1/378 Calculate prob of sequence sz when two letters picked without replacement from {v: 2, z: 9, s: 8}. 4/19 Four letters picked without replacement from hjhajaaahhaajaajaha. Give prob of sequence hhhh. 5/3876 Calculate prob of sequence vh when two letters picked without replacement from vhvvvvvvvvvv. 1/12 Two letters picked without replacement from {b: 1, n: 1, f: 2, o: 3, y: 3}. Give prob of sequence ff. 1/45 Four letters picked without replacement from psctpstffttpsft. What is prob of sequence tsfp? 3/728 Calculate prob of sequence nxx when three letters picked without replacement from {n: 2, x: 2, j: 1, i: 1}. 1/30 What is prob of sequence lsg when three letters picked without replacement from {i: 2, s: 4, g: 2, c: 2, l: 2, m: 2}? 2/273 Three letters picked without replacement from dllnnhwg. Give prob of sequence dng. 1/168 Two letters picked without replacement from {u: 4, o: 5, w: 7}. What is prob of sequence ww? 7/40 Three letters picked without replacement from sjjjsjsssjjsjjq. Give prob of sequence jjj. 8/65 Three letters picked without replacement from {c: 1, l: 7}. Give prob of sequence lll. 5/8 What is prob of sequence vi when two letters picked without replacement from {v: 5, i: 2, a: 5}? 5/66 What is prob of sequence qqhm when four letters picked without replacement from {q: 4, h: 2, m: 5, w: 1, e: 1, i: 2}? 1/273 Three letters picked without replacement from pejrpjvpvjpjv. Give prob of sequence jve. 1/143 What is prob of sequence iiu when three letters picked without replacement from ddiuiiuiiuiiiiiuidii? 26/285 Two letters picked without replacement from {l: 1, a: 2, s: 2, y: 6}. Give prob of sequence ya. 6/55 What is prob of sequence ffwf when four letters picked without replacement from {w: 2, f: 3}? 1/10 What is prob of sequence auc when three letters picked without replacement from caucacaccaacacaaccud? 2/95 What is prob of sequence gul when three letters picked without replacement from {u: 10, g: 5, l: 4, t: 1}? 5/171 Calculate prob of sequence jnj when three letters picked without replacement from {j: 3, n: 2}. 1/5 Calculate prob of sequence pgr when three letters picked without replacement from {o: 1, r: 1, g: 1, q: 1, p: 1}. 1/60 Four letters picked without replacement from qqqtlqst. Give prob of sequence ltsq. 1/210 Four letters picked without replacement from rrrmmm. What is prob of sequence rrmm? 1/10 Three letters picked without replacement from bbbbbbbbbbbkbbbbkb. What is prob of sequence bkb? 5/51 Three letters picked without replacement from {o: 8, p: 4, b: 1}. What is prob of sequence poo? 56/429 Calculate prob of sequence odf when three letters picked without replacement from {o: 3, u: 2, f: 2, d: 5}. 1/44 Two letters picked without replacement from llulullxphuplulluulu. Give prob of sequence xl. 9/380 Two letters picked without replacement from {h: 1, e: 3, l: 3, d: 1, w: 2, s: 1}. Give prob of sequence hl. 3/110 Calculate prob of sequence jsrp when four letters picked without replacement from yrrzjspp. 1/420 Two letters picked without replacement from pppppupppppp. What is prob of sequence up? 1/12 Calculate prob of sequence mh when two letters picked without replacement from {m: 3, h: 5, a: 1}. 5/24 Calculate prob of sequence nwwn when four letters picked without replacement from {w: 10, n: 2}. 1/66 Calculate prob of sequence oww when three letters picked without replacement from {o: 3, w: 8, f: 4, p: 4}. 28/969 Three letters picked without replacement from zddedzzzz. What is prob of sequence ddz? 5/84 Two letters picked without replacement from gkgklwhllugw. Give prob of sequence kl. 1/22 Four letters picked without replacement from {u: 12, t: 3}. What is prob of sequence utuu? 11/91 What is prob of sequence sc when two letters picked without replacement from {s: 1, q: 3, c: 4}? 1/14 What is prob of sequence psp when three letters picked without replacement from {p: 11, s: 9}? 11/76 Calculate prob of sequence jjj when three letters picked without replacement from lljljlllllllllljjl. 1/204 Calculate prob of sequence pl when two letters picked without replacement from llplplpllpllpppppppl. 99/380 Three letters picked without replacement from uiih. What is prob of sequence uhi? 1/12 Four letters picked without replacement from trrzarrfetartrfze. Give prob of sequen

Interpol at The Olympia Theatre – Review & Photos Share Interpol played the first of their three day residency at The Olympia Theatre tonight, February 10th. Interpol post-punk revivalists for the first of three shows arrived at the Olympia in Dublin as part of their El Pintor tour. Rock artists Health from LA intrigued on support, merging electro and rock into a hard to ignore sound. Blood coloured lights shone across Banks and the new Interpol live line-ups smirking faces. Smirking because, with the recent release of El Pintor, they know they are at the top of their game. Leading in with ‘Say Hello to The Angel’ and ‘Anywhere’, Interpol sucked the crowd into their inescapable vortex of sound. Now that limelight hogger Carlos D is a distant memory, Banks took over bass duties, while their live tour support balance their on-stage blend. During ‘Evil’, Banks’ dulcet vocal had the crowd by the crown jewels, singing with him while Kessler’s savage riffs and the bass lines riveted. For ‘Everything Is Wrong’, the synth took us on an epic trip across pixelated, distorted mountainous terrain. Interpol could be described as a refined and understated band. On-stage their artwork, which was fascinating, was demonstrated by subtle distortions and changes to the imagery and lighting. Daniel Kessler and Sam Fogarino were clearly in their element; there was nothing sombre about this performance, albeit dark, stylish outfits. This is a band absorbed in their art. Ending on a double encore, Interpol stunned us with ‘NYC’ and ‘PDA’ against a hypnotic visual backdrop, as the crowd chanted for more. After ‘Untitled’, they ended to a standing ovation, what more could Interpol’s fans have asked for? After a three year hiatus to refresh and return to their roots, Interpol delivered a rousing show at Dublin’s Olympia Theatre. Two more shows are to follow, and for lucky revellers who managed to get their hands on tickets, they are in for a treat. Set list:Say Hello to the Angels Anywhere My Blue Supreme Evil The New My Desire Rest My Chemistry Everything is wrong Lights Breaker 1 Pioneer to the Falls Narc Not Even Jail Slow Hands First encore:All the Rage Back Home NYC PDA

I would definitely add some layers beginning about the lip line. A fun heavy side bang will also help to achieve a fun new style. As for the color, I think its beautiful but if your looking for a change, you can always add some blond highlights to brighten and liven it up a tad.

2004–05 Temple Owls men's basketball team The 2004–05 Temple Owls men's basketball team represented Temple University in the 2004–05 NCAA Division I men's basketball season. They were led by head coach John Chaney and played their home games at the Liacouras Center. The Owls are members of the Atlantic 10 Conference. They finished the season 16–14, 11–5 in A-10 play, and reached the 2005 National Invitation Tournament. Roster References 2014-15 Temple Owls Men's Basketball Media Guide Temple Category:Temple Owls men's basketball seasons Temple Temple Temple

1990 Peach Bowl The 1990 Peach Bowl, part of the 1990 bowl game season, took place on December 29, 1990, at Atlanta–Fulton County Stadium in Atlanta, Georgia. The competing teams were the Auburn Tigers, representing the Southeastern Conference (SEC), and the Indiana Hoosiers of the Big Ten Conference (Big Ten). In what was the first ever meeting between the schools, Auburn was victorious in by a final score of 27–23. Teams Auburn The 1990 Auburn squad finished the regular season with a tie against Tennessee and losses to Florida, Southern Miss and Alabama en route to an overall record of seven wins, three losses and one tie (7–3–1). After their loss against Alabama in the Iron Bowl on December 1, Auburn officially accepted an invitation to play in the Peach Bowl. The appearance marked the first for Auburn in the Peach Bowl, and their 23rd overall bowl game. Indiana The 1990 Indiana squad opened the season with four consecutive wins before they tied Ohio State in their fifth game. The Hoosiers then went on a three game losing streak against Minnesota, Michigan and Michigan State. They then completed the regular season with a pair of wins and a loss against Illinois en route to an overall record of six wins, four losses and one tie (6–4–1). After their victory over Purdue in the season finale, the Hoosiers accepted a bid to play in the Peach Bowl. Their appearance marked the second for Indiana in the Peach Bowl, and their sixth overall bowl game. Game summary Auburn took an early 7–0 lead on a six-yard Stan White touchdown run, and the Hoosiers responded with a three-yard Trent Green touchdown run that tied the game 7–7 at the end of the first quarter. In the second quarter, the Tigers took a 14–7 lead after an 11-yard White touchdown pass to Alex Smith. Each team then scored a field goal before the end of the quarter that made the halftime score 17–10 in favor of Auburn. After a scoreless third quarter, Jim Von Wyl connected on a 42-yard field goal early in the fourth that extended the Tigers' lead to 20–10. The Hoosiers then took a 23–20 lead late in the quarter after Green scored on touchdown runs of two and eleven-yards. White then scored the game-winning touchdown with his one-yard run with only 0:39 left in the contest. For their individual performances, Stan White, Vaughn Dunbar and Darrel Crawford were recognized as game MVPs. References Peach Bowl Category:Peach Bowl Category:Auburn Tigers football bowl games Category:Indiana Hoosiers football bowl games Peach Bowl Category:December 1990 sports events in the United States

/* Auto-generated from php/php-langspec tests */ <?php /* +-------------------------------------------------------------+ | Copyright (c) 2014 Facebook, Inc. (http://www.facebook.com) | +-------------------------------------------------------------+ */ error_reporting(-1); include_once 'MathLibrary.inc'; // $m = new MathLibrary; // can't instantiate a final class MathLibrary::sin(2.34); MathLibrary::cos(2.34); MathLibrary::tan(2.34);

There are a wealth of opportunities available in the aviation industry. Five insiders explain what it takes to advance in a career above the clouds. – todd williams Stephanie Grant First Officer Atlantic Southeast Airlines “You have to want to do it like nothing else. You have to work hard, study and get a mentor. There are black female pilots and [black] male pilots. Grab one of us and we’ll walk you through the steps of becoming a commercial pilot. Flying is a skill, so the more you do it the better you are at it. We’re trained and we get better everyday.” James Gordon Captain, UPS President, Organization of Black Airline Pilots “As a pilot, you’ve got to be willing to communicate. You can’t be too thin-skinned, and you have to be able to take things light-heartedly. It’s a very serious profession — but there is some competition [also]. Competition is healthy … I’ve found that it’s caused me to excel to a greater level then I would have been able to [otherwise.]” Robin Rogers Flight Attendant Atlantic Southeast Airlines “It’s a very flexible career, [it’s] promising and fulfilling. You must be open-minded and always be professional. Understand that every day will be different … but every day isn’t always going to be easy.” Ernie Taylor First Officer Delta Airlines “Being an airline pilot, we enjoy what we’re doing and we want to give them an opportunity to do the same thing. You can get your pilot’s license almost at the same time you get your driver’s license. It’s not impossible to do, and you learn the [basics] in high school — math and science. The key to being successful is preparation.” Diana Galloway Flight Attendant Atlantic Southeast Airlines “We take many flights and meet lots of people. Every flight is a different experience. It does allow me time with my family and friends. For anyone aspiring to be a flight attendant — it’s excellent, but you must stay focused. You apply with an airline and go through an intense interview process which leads to training that lasts about a month.”

The Efficacy and Safety of High-Intensity Focused Ultrasound (HIFU) Therapy for Benign Thyroid Nodules-A Single Center Experience from Singapore. High-intensity focused ultrasound (HIFU) is a recent noninvasive technique of treating thyroid nodules. Our study aims to investigate the efficacy and safety of HIFU in treating benign thyroid nodules. This is a retrospective analysis of consecutive patients who underwent HIFU of benign thyroid nodules at our institution from July 2017-2018. All procedures were performed by a single surgeon. Patients were evaluated immediately post-procedure, and at subsequent intervals of 1 week, 1 month, 3 months, and 6 months. The primary endpoint was thyroid nodule volume reduction at 6 months posttreatment. Secondary endpoints were post-procedure local complications. Ten patients with 13 thyroid nodules were included. The median follow-up period was 426 days (range 238-573). Mean maximum diameter reduced from 2.6 cm (±0.8) pretreatment to 1.4 cm (±0.7, P < 0.05) 6 months posttreatment. Mean nodule volume reduced from 5.2 cm3 (±4.2) pretreatment to 1.5 cm3 (±1.3, P = 0.01) 6 months posttreatment. Mean volume reduction ratio (VRR) at 6 months posttreatment was 63.2% (±22.5, P < 0.05), with volume reduction of ≥50% in 10 of 13 (76.9%) nodules. Two nodules (15.4%) showed size increases from 4 months posttreatment. No patients experienced local skin burns or hematomas. Mean pain scores were 1.5 (±1.2) immediate post-procedure, 0.8 (±1.5) at 1 week, and 0.6 (±1.2) at 1 month post-procedure, respectively, with no reports of pain beyond 1 month. Only two (20.0%) patients had early, temporary posttreatment voice hoarseness. Our study shows HIFU ablation to be efficacious and safe-with significant thyroid nodule volume reductions, and no significant or prolonged local complications.

45Press - Web Development 45PRESS is a WordPress development and WordPress hosting company based in Austintown, OH. 45Press - Web Development is located in Youngstown city of Ohio state. On the street of Mahoning Avenue and street number is 5667. To communicate or ask something with the place, the Phone number is (330) 953-1745 if you don't know how to go 45Press - Web Development click here. You can get more information from their website 45press.com. About Place Lookup Is your quest for a professional website that helps to access phone numbers, geographical locations and addresses of places in the USA? PlaceLookup.Net is the right place to visit because we have the resources to provide clients top-notch that counts. read more

- 4 for i. 1 Let a be (-2)/(-5) + 52/20. Let i be -4 + (-136)/(-16) + 3/(-6). Solve 0 = i*j + a*j - 35 for j. 5 Let q be (5 - 13) + 17 - 31. Let u(t) = t**3 + 22*t**2 - 4*t - 88. Let h be u(q). Solve -25 = -5*f - h*f for f. 5 Let k = -239 + 222. Let c(t) = -t**2 - 21*t - 67. Let i be c(k). Solve i = m + 1 for m. 0 Let w = 1941 - 1934. Solve 65 + w = 24*p for p. 3 Let v(b) = 11*b + 4. Let j = 680 + -680. Let u be v(j). Solve 1 = u*a - 3 for a. 1 Suppose 0*i = -4*i + 28. Let j(b) be the first derivative of -b**3/3 + 6*b**2 - 31*b - 900. Let o be j(i). Solve 0 = -o*x + 6 + 6 for x. 3 Let n be -13 + 999/(-3 + 12). Solve 0 = -13*i - 150 + n for i. -4 Let a be 131/5 + (-24)/(-30). Suppose a = 7*l + 2*l. Solve l*q - 16 + 1 = 0 for q. 5 Let g be 350/4 + (-2)/(16/(-12)). Suppose 81 = -2*h + g. Suppose 0 = -k + 6*k - 10. Solve k = -l + h for l. 2 Let v = -214 - -422. Suppose -28*n = -20*n - v. Solve -21 = w - n for w. 5 Suppose -6*d + 148 = 1348. Let l = d - -210. Solve -4*w + 2 = l for w. -2 Suppose 2*i + 363 = -3*o, -2*i + 2*o - 167 = 191. Let y = i - -185. Solve c - y = -10 for c. -5 Let j(d) = 18*d**2 - 5 + 4*d**2 + d**3 + 21*d + 9. Let b be j(-21). Let q(n) = n**2 + 5*n - 4. Let c be q(-6). Solve b*k = c*k + 10 for k. 5 Suppose -5*q + 267 = -193. Let l = -87 + q. Suppose 0 = -7*i - l + 26. Solve 2*p - 5 = -i for p. 1 Let p = 307 - 129. Let v = -175 + p. Solve -2*g + 5 = -v for g. 4 Let a = 70 + -195. Let j = a - -125. Solve 35 = -7*w - j*w for w. -5 Let s be 612/38 + (-16)/456*3. Solve 50 = 26*y - s*y for y. 5 Let h = 235 - 96. Suppose 4*z = h - 43. Let b = 27 - z. Solve -11 - 4 = -b*c for c. 5 Suppose 2*a - 57 = -3*x, 3*a - 2*x - 11 - 107 = 0. Solve a = -202*i + 193*i for i. -4 Let w = -114 - -204. Let f be -3*2/4 + w/20. Solve f = h + 4 for h. -1 Suppose -60*g = -1195 - 185. Solve -g + 78 = -11*a for a. -5 Suppose -l = 3*i - 74, 15*l - 153 + 55 = -i. Let y = -28 + 53. Solve -y = -2*s - i for s. 1 Let w be ((-5)/1)/(-3 - (0 + -2)). Suppose 4*q - w*k = 69, -4*q + 19 = 2*k + 3*k. Suppose 1 = 4*g - q. Solve 0*a + g*a = -9 for a. -3 Let u be (-1)/(-3*(-6)/(-54)) - (-243 - -13). Solve 235*b - u*b = -12 for b. -6 Suppose -2*s + 6 = -8. Suppose s*u + 1 = 29. Solve -u*j - 16 = -4 for j. -3 Let m be (-1384)/(-44) - 7*(-5 + (-1895)/(-385)). Solve -m*p + 23*p + 9 = 0 for p. 1 Let y be (5/15)/((-2)/(-12)). Suppose -d - 4*h = -9, -17 = -3*d - 8*h + 6*h. Solve -d*i - y = -7 for i. 1 Suppose -1 = -2*i + 2*o + 9, i - 7 = 3*o. Solve 0 = 33*d - 29*d + i for d. -1 Suppose c + 13 = 2*c + 2*b, 3*c - 2*b = 23. Let u = c - 0. Let t = 19 - u. Solve 3*k = -2 - t for k. -4 Let q = 4374 - 4374. Solve q = -6*l - 11*l - 102 for l. -6 Let x(y) = y**3 - 5*y**2 + 34*y - 126. Let g be x(7). Solve g*r = 213*r + 3 for r. -1 Let t be (-82)/((-4)/3*(-237)/(-158)). Solve -8*a + t - 81 = 0 for a. -5 Let k(x) = 5*x - 87. Suppose 48 = 2*g + 3*f, -g + 40 = g + f. Let n be k(g). Solve -n*j + 4 = 10 for j. -2 Let o be -6*(-1 + -11)/6. Solve -133*l = -129*l - o for l. 3 Let p(b) = b**3 + 12*b**2 + 9*b + 110. Let z be p(-12). Let v(j) = -2*j + 12. Let g be v(5). Solve -g = -z*i - 0 for i. 1 Suppose 29 = 7*j + 1. Let h be (-1 - -7)*((-38)/j + 2). Let q = h + 65. Solve d = -4*d - q for d. -4 Suppose 4*r = 2*b + 2, -4*r - 4*b - 55 = -75. Solve 10*s - 12 = -r*s for s. 1 Suppose -5*o + v + 910 = 0, 1257 = -o + 4*v + 1439. Solve -161 = 49*j + o for j. -7 Let z be (8 - 6) + -10 - -8. Suppose 2*f + 7*f = z. Let y be 2/(-4) + (-10)/(-4). Solve f*n = y*n - 4 for n. 2 Let t be (100/18)/(19/171). Solve 2*o + 42 - t = 0 for o. 4 Let n(c) = -10*c + 6. Let k be n(1). Let l be (-1)/k - 3689/(-124). Solve 0 = -3*i - 7*i - l for i. -3 Suppose -5*w - 6020 = -12*w - 21*w. Solve 206*g - 54 = w*g for g. -6 Suppose -12 = 3*w - 6*w. Suppose 5*u - m = 22, m - w = -1. Let b = -1049 - -1065. Solve -u*i = -i - b for i. 4 Let a be 11358/4 + -4 + 36/8. Let r(m) = 0*m - a - m + 2841. Let t be r(-1). Solve 0 = -h - 0 - t for h. -2 Suppose 26595 + 20268 = 41*c. Solve -1149*i + c*i + 18 = 0 for i. 3 Let o(v) = -7*v - 18. Let n be o(-9). Let t = -39 + n. Suppose -t*f + 2*f = -16. Solve f + 0 = 4*b for b. 1 Suppose -3*o + 81 = 4*v, 0 = 4*o + 5*v - 18 - 89. Suppose -4*z + 3 = -37. Let p be o + z/((-10)/(-2)). Solve n + 4*n - p = 0 for n. 5 Let l be -1 + 80/64*4. Solve -l = -538*k + 540*k for k. -2 Suppose 0 = 3*a + 4*y - 18, -5*a + y - 5*y + 22 = 0. Suppose 0 = -3*u + 7 + a. Solve -u*q = q for q. 0 Let f(a) = a**2 - 11*a. Let u be f(11). Suppose 5*o + 0*w = -2*w - 126, u = 3*o - 5*w + 88. Let d = -23 - o. Solve 1 = -d*x - 2 for x. -1 Suppose 3*h = -s + 15, -43*s + 3*h + 75 = -38*s. Suppose -s*g = 22*g - 333. Solve 4*w - 13 + g = 0 for w. 1 Let h(q) = -8*q**2 + 17*q - 44. Let v be h(8). Let n = -416 - v. Solve 2*l = 6*l - n for l. 1 Let w(x) = 2*x**2 - 76*x + 732. Let s be w(16). Solve s*u - 19*u - 63 = 0 for u. 7 Let m be (1 + 10)*(-185)/74*(-6)/15. Solve 167 - 200 = m*d for d. -3 Let v(d) = d**2 - 13*d - 63. Let c be v(-8). Suppose -25 = 4*m - c. Solve -m = 4*p - 8 for p. -3 Let y = -7 + 3. Let h(r) be the second derivative of r**4/6 + 4*r**3/3 + r**2 + 15*r. Let n be h(y). Solve -2*b + b + n = 0 for b. 2 Let o(z) be the third derivative of z**6/120 - 37*z**5/60 - 37*z**4/24 - 11*z**3/2 + 16*z**2. Let q be o(38). Solve -5*f - q = 20 for f. -5 Let w be ((-6)/4)/((-51)/(-68)). Let u be 0 - w/7 - (-338)/91. Suppose -2*m = c - 0*m, 0 = -5*c - u*m + 6. Solve -c*i = 2*i + 16 for i. -4 Suppose -102 = -34*t - 11*t + 33. Suppose -j - 15 = -3*z, -2*z = 2*z + j - 20. Let o = -5 + z. Solve t*k + 4 - 7 = o for k. 1 Let o be ((-36)/42)/2 - (-4)/(-7). Let u be 8 + o/((-5)/5). Suppose -21 = -4*y - u. Solve c + 6 = y*c for c. 3 Let o be (-12)/(-14)*(-199794)/(-1278). Solve -o + 134 = -b for b. 0 Let k = -128 - -140. Let i be (-16)/24 + ((-17)/(-3) - 1). Solve -k = -4*t - i for t. 2 Let q be 4 - (-5)/((-5)/43). Let j be (-3)/(-1)*26/q. Let m be j - (4 - (8 - -1)). Solve -h - 1 = m for h. -4 Let l(i) = 53*i - 3. Let o(a) = -52*a + 4. Let v(m) = 4*l(m) + 5*o(m). Let k be v(1). Let j = k - -44. Solve d - j = 3*d for d. -2 Suppose -4*u + 5*o = -5*u - 44, 5*o = 0. Let l = -40 - u. Solve -l*n + 0*n = -16 for n. 4 Let u = -385 - -416. Suppose 39*g = u*g + 56. Solve 0 = -2*s - 5*s - g for s. -1 Suppose 5*d = -3*i - 5, -d - i = 4*i + 23. Solve -d - 13 = 5*t for t. -3 Let o be (-10)/2 - 273/14*(6 + -14). Solve 166*u - o*u + 105 = 0 for u. -7 Let y(l) = -16 + 10 - 4. Let d(a) = a - 49. Let m(q) = 2*d(q) - 11*y(q). Let n be m(-5). Solve n*v = -3*v - 20 for v. -4 Let l = 339 + -336. Suppose -l*v - v - 4*d = -32, -4*v + 31 = 3*d. Solve -2 = v*a - 9 for a. 1 Suppose -123 - 205 = 4*p. Suppose 341*g - 348 = 337*g. Let m = g + p. Solve 15 = m*n - 8*n for n. -5 Let v(m) = 24*m + 24. Let y be v(15). Suppose 0 = -4*b + 3*a + y, 0*b - a = b - 103. Suppose 0 = -7*s - 4*s + b. Solve 0 = -s*w + 4*w for w. 0 Let y(o) = 13*o - 3. Suppose 3*a - 8 = -2*w, -a - 3 = -6*w + w. Let s be y(a). Let f = -3 + s. Solve -b - f = -5*b for b. 5 Suppose 5*i - 1474 = -2*a, -5853 = 4*a - 5841. Solve -299*g = -i*g for g. 0 Suppose -30 = 50*f - 55*f. Let a be ((-4)/f)/((-4)/12). Solve -a = -2*w + 4 for w. 3 Let i(b) = -4 + b - 2*b + 1. Let r be i(-5). Suppose 852 = 29*a + 562. Solve r*h + a = 2 for h. -4 Suppose -k = 58 + 26. Let g be (-189)/k + (-2)/8. Solve -g*z - 10 = -0 for z. -5 Let z be ((-2)/(-8) + 15669/(-180))*340/(-17). Solve -1729*t + 35 = -z*t for t. -5 Let r(q) = q**3 - 29*q**2 + 110*q + 5. Let k be r(4). Solve -9 = 12*l - k for l. 3 Let a = -77 + 88. Suppose -2*l - 4 = 4*s, 5 = 2*l - s - a. Let u(g) = 3*g - 14. Let b be u(l). Solve -h + 0*h = -b for h. 4 Suppose -5*z = 5*j - 6*z + 113, -4*j - 88 = -2*z. Let u = 28 + j. Solve 2*l + u = 11 for l. 3 Let t = -13943 - -14055. Solve 5*v + t = 33*v for v. 4 Suppose 0 = 5*i - 5*h - 15465, 9*i - 2*h - 12358 = 5*i. Solve -b + i = 3083 for b. 3 Let k(c) = -3*c - 7. Suppose 4*w = -13 - 3. Let f be k(w). Suppose 0 = -f*r - x + 20, 3*r - 2*x - 11 - 1 = 0. Solve -l + 6 = -r*l for l. -2 Suppose -30 + 4 = -13*f. Suppose 0 = -10*x + 13*x - 6. Suppose -7*b + 2*q - 4 = -f*b, -4*b + q - x = 0. Solve b = 2*t - 4*t + 4 for t. 2 Let v(s) = -5*s**2 + 14*s - 84. Let j(n) = 4*n**2 - 15*n + 83. Let z(m) = 4*j(m) + 3*v(m). Let l be z(12). Solve 5*o +

Thirteen years ago today I purchased this domain. According to Wayback Machine I referred to March 15th as my official “Hello World.” Which was about a week and a half after WordPress 1.5 was officially released. It wasn’t a coincidence. I’d been toying with starting a blog for a couple of months, looking at all of the “free” options and being unsatisfied. Digging deeper, I found WordPress. This was still 1.2 with no real theme or plugin system – my-hacks.php y’all. Anyway, I started playing with the beta and figuring out how to get it installed on a shared server with “pretty permalinks”. Soon after the stable release I settled on a url and jumped in. About the name—I get this question often. Back in the days of arcade and console games when you got a high score or save position, often the user name was 3 characters. My initials never clicked for me so I used MIK. In high school, I was Michael B. Somewhere between the 2 I came up with the user name miklb and it was a short domain and truthfully, I didn’t know what I was doing. Also, all variations of Michael & Bishop were taken, dominated by a star college quarterback in Kansas. Armed with Smultron, Cyberduck and a desire to make my own website and blog, here I am, writing this post in Atom Editor(very much the Smultron of today), which will make it’s way to a blog post on a site running a very much different version of WordPress than where it started. Thank you to every single one of you who’ve provided help, insight and friendship along this journey.

First bid to use CRISPR to edit human genes up for federal review A federal panel will get its first look next week at a proposal to use the revolutionary gene-editing technology CRISPR in humans, in this case to try to treat cancer. The experiment, proposed by the University of Pennsylvania, would remove certain cells of the immune system, called T cells, from cancer patients. Scientists would then use CRISPR to genetically modify the T cells so that when they’re returned to the patient, they target and destroy myeloma, melanoma, and sarcoma tumor cells. Carrie Wolinetz, the associate director for science policy at the National Institutes of Health, disclosed the review in a blog post, which was first reported by MIT Technology Review. The federal panel must review all human experiments that alter DNA. advertisement A biotech company, Editas Medicine in Cambridge, Mass., had been expected to be the first to use CRISPR in people, in an effort to treat a rare eye disease. But it looks like Penn might beat Editas to the punch. Penn scientist Dr. Carl June pioneered the use of genetically modified T cells, called CAR-T’s, as a cancer treatment. So far, researchers have used traditional genetic engineering to make the cells home in on the molecules that stick out of tumor cells. But that’s less efficient and often less precise than CRISPR. Penn is reportedly seeking NIH approval to use CRISPR to edit out two genes in T cells. One, called PD-1, suppresses the ability of T cells to attack tumors. The other is a T cell receptor that can turn the body’s natural defenses against itself. The medical significance of the proposal is not clear, since gene editing has already been used in humans — just not gene editing via the CRISPR-Cas9 system. Sign up for The Readout A different genome-editing technique, called TALEN, was used to modify T cells to treat a British toddler with leukemia last year. That was the first time TALEN had been used to treat a patient. A third genome-editing technique, called zinc fingers, is in an advanced clinical trial sponsored by California-based biotech Sangamo BioSciences to treat AIDS, with promising results in more than 80 patients. Big money has lined up behind each of the rival genome-editing techniques. Seattle’s Juno Therapeutics promised Editas as much as $737 million to use its CRISPR technology in CAR-T research, while Novartis entered a $280 million alliance with Intellia Therapeutics.

Codesign.io is now #1 on ProductHunt - pavelk2 http://www.producthunt.com/tech/codesign-io ====== pavelk2 Codesign.io is a minimal project management tool for visual projects such as web-sites, logos, presentations, photos or anything else that can be viewed as an image. Codesign is a great tool for studios and agencies collaborating with their clients. Codesign makes this collaboration clean, simple and well- organized.

Choline transport into rat liver mitochondria. Characterization and kinetics of a specific transporter. Rat liver mitochondria possess a specific choline transporter in the inner membrane. The transporter shows saturable kinetics at high membrane potential with a Km of 220 microM and a Vmax of 0.4 nmol/mg of protein/min at pH 7.0 and 25 degrees C. At physiological concentrations of choline, the rate of choline uptake by the transporter shows a linear dependence on membrane potential; uptake is distinct from the nonspecific cation diffusion process. Hemicholinium-3, hemicholinium-15, quinine, and quinidine, all analogues of choline, are high affinity competitive inhibitors of choline transport with Ki values of 17, 55, 15, and 127 microM, respectively. The choline transporter is distinct from other known mitochondrial transporters. Rat heart mitochondria do not appear to possess a choline transporter. Evidence suggests that the transporter is an electrophoretic uniporter. Analogue studies have shown that the hydroxyl and the quaternary ammonium groups of choline are necessary for binding to the transporter. A comparison of molecular models of choline and the high affinity inhibitors has provided evidence for the preferred conformation of choline for binding to the transporter. The presence of a choline transporter in the mitochondrial inner membrane provides a potential site for control of choline oxidation and hence supply of endogenous betaine.

Les Roquetes, Barcelona Les Roquetes is a neighborhood in the Nou Barris district of the city of Barcelona, Catalonia, Spain. Roquetes metro station, on line L3 of the Barcelona Metro, lies in the neighbourhood. References Roquetes Category:Nou Barris

Q: Efficient bit operations In C++ I want to encode the bits of 3 unsigned variables into one. More precisely, when the three variables are: A: a3 a2 a1 a0 B: b3 b2 b1 b0 C: c3 c2 c1 c0 then the output variable shall contain such triples: D: a3 b3 c3 a2 b2 c2 a1 b1 c1 a0 b0 c0 Let's assume that the output variable is large enough for all used bits. I have come up with unsigned long long result(0); unsigned a,b,c; // Some numbers to be encoded for(int level=0;level<numLevels;++level) { int q(1<<level); // SearchBit q: 1<<level int baseShift((3*level)-level); // 0,2,4,6 result|=( ((a&q)<<(baseShift+2)) | ((b&q)<<(baseShift+1)) | ((c&q)<<(baseShift)) ); } ...and it works sufficiently. But I wonder if there is a solution that does not require a loop that iterates over all bits separately. A: Define a table mapping all or part of your bits to where they end up. Shift values appropriately. unsigned long long encoder(unsigned a, unsigned b, unsigned c) { static unsigned const encoding[16] = { 0b0000000000, 0b0000000001, 0b0000001000, 0b0000001001, 0b0001000000, 0b0001000001, 0b0001001000, 0b0001001001, 0b1000000000, 0b1000000001, 0b1000001000, 0b1000001001, 0b1001000000, 0b1001000001, 0b1001001000, 0b1001001001, }; unsigned long long result(0); int shift = 0; do { result += ((encoding[a & 0xF] << 2) | (encoding[b & 0xF] << 1) | encoding[c & 0xF]) << shift; shift += 12; a >>= 4; b >>= 4; c >>= 4; } while (a || b || c); return result; } encoding defines a table to map 4 bits into their encoded locations. This used directly for c, and shifted 1 or 2 bits for b and a. If you have more than 4 bits to process, the next 4 bits in the source values are offset 12 bits further to the left. Keep doing this until all nonzero bits have been processed. This could use a while loop instead of a do/while but checking for zero before starting is useless unless most of the encodings are of all zero values. If you frequently use more than 4 bits, the encoding table can be expanded and appropriate changes made to the loop to process more than 4 bits at a time.

Adyumba people The Adyumba or Adjumba are an ethnic group in Gabon. They live mainly near Lake Azingo and in the Middle Ogooué River in the west coast of the country. They belong to the Myènè people and also speak the Myènè language of the Bantu languages. Their neighbors include the Mpongwe people (who they were historically considered a clan of) and the Nkomi people. Today most live by fishing, food crops and small businesses. References Bibliography David E. Gardinier, Historical dictionary of Gabon, Scarecrow Press, Metuchen, Londres, 1994, 466 p. Karl David Patterson, The northern Gabon coast to 1875, Clarendon Press, Oxford, 1975, 167 p. Albert Aléwina Chavihot et Jean-Avéno Davin, Les Adyumba du Gabon : de la petite valise de Nènè, Éditions Raponda Walker, Libreville, 2000, 196 p. Elikia M'Bokolo, Noirs et blancs en Afrique équatoriale : les sociétés côtières et la pénétration française, vers 1820-1874, Éditions de l'École des hautes études en sciences sociales, 1981, 302 p. Category:Ethnic groups in Gabon

The code used for this work is available at <http://hdl.handle.net/11299/174710>. Introduction {#sec001} ============ Tumor therapy with replication competent viruses (oncolytic virotherapy) is an exciting new field of therapeutics. In principle, amplification of the virus in target cancer cells could allow ongoing spread of the infection within the tumor and its eventual elimination \[[@pcbi.1006773.ref001], [@pcbi.1006773.ref002]\]. The advantages of recombinant viruses for cancer therapy include (i) specific engineering for infection, replication and killing of tumor cells \[[@pcbi.1006773.ref001]\], (ii) amplification of the therapy itself by the tumor, (iii) stimulation of an anti-tumor immune response by breakdown of tumor immune tolerance \[[@pcbi.1006773.ref003]\], (iv) a bystander effect especially if the virus is armed with specific genes such as the sodium iodide symporter (NIS) \[[@pcbi.1006773.ref004]\]. With the exception of cancer therapy with recombinant chimeric antigen receptor (CAR-T) T cells, tumor virotherapy is an exercise in population dynamics in which the interactions between the virus, the tumor and the immune system determine the outcome of therapy \[[@pcbi.1006773.ref005]--[@pcbi.1006773.ref013]\]. Many mathematical models have been developed to describe the outcome of such interactions \[[@pcbi.1006773.ref005], [@pcbi.1006773.ref006], [@pcbi.1006773.ref008]--[@pcbi.1006773.ref013]\]. Most models are based on the Lotka-Volterra approach and assume mass action kinetics with well-mixed populations. As a result, the models are helpful in illustrating general principles but lack important features, in particular the spatial geometry of the cells in a tumor, to be of predictive value if applied to in vivo scenarios. This is a critical deficiency especially if we are to attempt optimization of therapy \[[@pcbi.1006773.ref009]\]. Durrett and Levin and many others have addressed the problem of spatial constraints on the interactions between populations in ecological systems \[[@pcbi.1006773.ref014]--[@pcbi.1006773.ref016] and reference therein\]. More recently, Paiva et al described a three-dimensional computational simulator of tumor and virus interactions and concluded that complex dynamics are in place with the spatial arrangements between cells being important determinants of outcome \[[@pcbi.1006773.ref017]\]. Reis et al reported on a 3D computational model of cancer therapy that illustrated the important differences when considering dynamics in 2 versus 3 dimensions and how restricted the parameter space may be to achieve tumor eradication \[[@pcbi.1006773.ref018]\]. Wodarz and colleagues have reported on their work with agent based modeling of tumor virotherapy where space is explicitly considered \[[@pcbi.1006773.ref007], [@pcbi.1006773.ref019]\]. Using experimental data on the spread of adenovirus in a monolayer (2D) of 293T cells as a guide, they showed that various patterns of virus spread such as 'hollow ring structure', 'filled ring structure' and a 'dispersed pattern' are possible and how space and virus/tumor cell parameters can interact to determine the outcome of therapy \[[@pcbi.1006773.ref007]\]. Ring structure formation is associated with a quadratic growth of the virus population which subsequently becomes linear. The dispersed pattern of spread is invariably associated with therapeutic failure while the ring structures may be associated with a cure especially if the center of the ring is associated with elimination of the target population and the virus continues to expand radially and catch up with all the target population (since a boundary will be reached). Wodarz and colleagues found that the local dynamics on a smaller scale can predict the outcome of the spatially explicit system \[[@pcbi.1006773.ref007]\]. Interestingly, the experiments also showed two patterns of infection--limited spread versus robust expansion of the infected cell population. Which pattern the infection followed was established early on. Subsequently, they showed that in part this dichotomy in outcomes was due to interferon induction in infected cells that inhibited virus spread \[[@pcbi.1006773.ref019]\]. This suggests that there is a local race between spread of the virus against the development of an interferon response which limits viral replication. Modeling suggests that multiple infections by the virus are also necessary to explain the dynamics, especially when the populations are small. However, many modeling approaches described to date have generally lacked any experimental data to validate them. To address this problem, we have developed an *in silico* computational model that captures the dynamics between the tumor and virus populations in a spatially explicit manner (two and three dimensions). We use in vitro 2D and 3D data to inform the model parameters and then use the computational model to explore various critical properties of oncolytic viruses. We show that the introduction of a third dimension alters the dynamics significantly and that this has important implications for the outcome of therapy. Results {#sec002} ======= In vitro cell dynamics {#sec003} ---------------------- To quantitate cell populations based on fluorescent imaging, we initially determined the pixel area that represents a cell. Two independent observers quantitated the number of cells (n = 375 cells per time point per observer) in a given area based on phase contrast images and the pixel area of the cells in the corresponding fluorescent images. The median number of pixels was 326.9 versus 323 (p = 0.8723, Mann Whitney) for each observer. There was excellent agreement between the two observers ([Fig 1A](#pcbi.1006773.g001){ref-type="fig"}). This means that the inter observer variability in cell area was 1.1%. The number of cells present in a growing population was measured at 6 different time points. We determined that the cell populations grew exponentially in 2D culture ([Fig 1B](#pcbi.1006773.g001){ref-type="fig"}). The estimated doubling time for the population was 28 hours based on an exponential fit to the data. In contrast, the rate of replication of *individual* cells based on serial tracking was estimated to be 21.9 hours ([Fig 1C](#pcbi.1006773.g001){ref-type="fig"}) and varied from 20 hours for the first replication (n = 127 events) to 22.5 hours for the second (n = 97 events). The difference between these two observations was not statistically significant (Wilcoxon sign rank test, p = 0.6563). There was a strong positive correlation between the two cell cycle times observed (Spearman's rho = 0.795, p = 0.0072). {#pcbi.1006773.g001} We measured the growth of tumor cells in 3 dimensions serially by imaging multiple spheroids at specific time points ([Fig 2A](#pcbi.1006773.g002){ref-type="fig"}). Each spheroid was monochromatic, implying that each spheroid arose from one founder cell even though a mixture of HT1080 cells with all 4 colors (blue, yellow, green and red) were plated. We found a linear increase in diameter of the spheroids as a function of time although there was considerable variability as the spheroids grew ([Fig 2D](#pcbi.1006773.g002){ref-type="fig"}). The median increase in spheroid diameter was 15μm/day or 0.63 μm/hr. In addition, we also determined the radius of gyration of representative spheroids (*n* = 12) across the 3 axes of growth as a function of time \[[@pcbi.1006773.ref020]\]. As can be seen from [Fig 2E](#pcbi.1006773.g002){ref-type="fig"}, the tumor cells growing in 3D generally retained a spherical shape with a median radius of gyration of 97.5μm in the XY plane, 114μm in the XZ plane and 101.7 μm in the YZ plane. Given that the average diameter of a cell is ≈10μm, our observations suggest that the variability in the radius of gyration was of approximately 1 cell in any axis and therefore growth of the spheroids was generally uniform in all directions. {#pcbi.1006773.g002} Nearest neighbors in 2D and 3D {#sec004} ------------------------------ Since oncolytic measles viruses (as well as other viruses) generally spread from cell to cell, we hypothesized that the number of cells surrounding any given cell is of critical importance. Therefore, we wanted to determine the number of nearest cell neighbors based on whether cells are growing in the 2D plane versus in 3 dimensions. This data informed the development of the computational model to realistically simulate the in vitro dynamics. We studied cell populations by Voronoi tessellation analysis to determine the distribution of nearest neighbors for cells growing in the 2D ([Fig 3A and 3B](#pcbi.1006773.g003){ref-type="fig"}) plane as well as in spheroids ([Fig 3C and 3D](#pcbi.1006773.g003){ref-type="fig"}). As expected, the number of nearest neighbors was significantly different in 2D versus 3D with a median of 6 (range: 3--10) versus 16 (range: 4--30) neighbors respectively. {#pcbi.1006773.g003} Virus spread in vitro in 2D and 3D {#sec005} ---------------------------------- We utilized serial imaging studies to determine the rate of growth of the tumor and virus infected cell populations both in the 2D plane and in 3 dimensions. A total of 14 independent experiments were studied in 2D. [Fig 4](#pcbi.1006773.g004){ref-type="fig"} presents snapshots of the spread of a single focus of infection (green) due to syncytium formation where cells fuse together to form a multicellular object. In [Fig 5A--5C](#pcbi.1006773.g005){ref-type="fig"}, we provide a representative case of data capture, digitalization and then analysis of cell population size by the Voronoi tessellation method (C). Fitting of serial imaging data to the mean field solution (see methods), enabled us to determine the best parameter estimates for cell replication and virus spread ([Fig 5D](#pcbi.1006773.g005){ref-type="fig"}). Although the rates of tumor cell and virus spread varied, the median rate of replication for tumor cells was 4.39 per hour while the virus infection was spreading at a median rate of 18.94 cells/hour which implies that the virus was spreading 4--5 times as quickly as the tumor cell population was growing. A faster rate of spread of the virus compared to tumor cell growth is a necessary condition for any plausible scenario where the virus can eliminate the tumor cell population leading to a potential cure--something that is *consistently* observed in vitro \[[@pcbi.1006773.ref021], [@pcbi.1006773.ref022]\] and also predicted by others \[[@pcbi.1006773.ref007], [@pcbi.1006773.ref019]\]. We used the *best estimate* of the parameter set obtained from the data fitting (the black dot in [Fig 5D](#pcbi.1006773.g005){ref-type="fig"}) to determine cell population size and compare that to the actual measurements. As can be seen from [Fig 5E](#pcbi.1006773.g005){ref-type="fig"}, the computational output mirrored the experimental results with a high degree of accuracy. In virtually all of our experiments with cells growing in the 2D plane, the virus consistently eliminated the tumor cell population within 48 hours. {#pcbi.1006773.g004} {#pcbi.1006773.g005} The dynamics of virus spread in 3D tumor spheroids were surprisingly different with the virus spreading more slowly in the 3D environment. Although various independent foci of infection occurred in each spheroid ([Fig 6](#pcbi.1006773.g006){ref-type="fig"}), with the formation of multinucleated syncytia (red), many infected cells remained viable for the duration of the experiment (\~7 days). We also observed that many cells in the spheroids never become infected despite being in close proximity to virus-infected cells. More recently we documented syncytium formation in vivo in a mouse dorsal skin fold chamber model of cancer growth (Kemler et al--submitted) where again we observed cells in close proximity to highly infected foci that did not become infected for the duration of the experiment. {#pcbi.1006773.g006} Simulations of virus spread in 2D and 3D {#sec006} ---------------------------------------- We utilized these observations to perform *in silico* simulations of cell dynamics either in the 2D plane or in 3 dimensions each under two scenarios: growth on a regular lattice or growth on a Voronoi lattice. We studied the dynamics across a wide range of parameter estimates (Figs [7](#pcbi.1006773.g007){ref-type="fig"} and [8](#pcbi.1006773.g008){ref-type="fig"}). All four networks studied had 1 × 10^6^ nodes with the 2D networks having a dimension of 1000 × 1000 while the 3D networks had 100 × 100 × 100 dimensions. At the start of each simulation, 90% of the nodes were occupied by normal cells, 9% were occupied by cancer cells and the initial viral inoculum infects 1% of the tumor cell population. If these simulations were allowed to run on an infinitely large and complete network (appropriately defined), the simulations would be stochastically identical to the mean field equations (see Methods). {#pcbi.1006773.g007} {#pcbi.1006773.g008} Starting with simulations in 2D, for the set of parameters chosen, simulations led to equilibria with the three cell populations present. The time to reach an equilibrium in the 2D regular lattice architecture was \~6000 time units (average number of neighbors: 4), while in the 2D Voronoi lattice (average number of neighbors: 6), the time to equilibrium was 5000 time units. In the case of 3D simulations, the time to equilibrium on the regular lattice (average number of neighbors: 6) was 250 time units, while in the case of the 3D Voronoi lattice (average number of neighbors: 16), the average time to equilibrium was 150 time units. Therefore, the main determinant of the speed to reach equilibrium is the dimensionality of the network more than the number of neighbors, although the latter is also important. In Figs [7](#pcbi.1006773.g007){ref-type="fig"} and [8](#pcbi.1006773.g008){ref-type="fig"}, we illustrate specific examples of such simulations in 2D ([Fig 7](#pcbi.1006773.g007){ref-type="fig"}) and 3D ([Fig 8](#pcbi.1006773.g008){ref-type="fig"}). In parallel, we also determined the results of the mean field solutions given by the mathematical model. It is clear that the mean field solution overestimates the effect of therapy with a larger population of infected tumor cells at equilibrium both in the 2D and 3D simulations. The mean field solution also overestimates the speed at which equilibrium is reached. Spread of the virus in 3D leads to a larger fraction of tumor cells infected at equilibrium compared to the 2D scenario but overall the tumor cell population is larger at equilibrium in the 3D network and illustrates the difficulty of controlling the 3D tumor compared to the tumor cells growing in vitro. There are also striking differences in the pattern of infection in 2D versus 3D that again illustrates the role of connectivity between cells. Simulations and equilibrium analysis {#sec007} ------------------------------------ There are five outcomes of tumor virotherapy regardless of the model and number of dimensions considered. (i) The tumor population will go extinct and the virus infected tumor population will soon follow, leading to permanent cure of the tumor. (ii) The virus infected cell population goes extinct and the result will be the eventual takeover of the simulation space by the tumor cells since they grow faster than normal cells. This will mean that therapy has failed. (iii) The three populations of cells co-exist and have a (non zero) stable size. This will imply partial success of therapy. (iv) Normal cells are eliminated and at equilibrium only tumor cells and infected tumor cells coexist. (v) All populations die out. We do not consider the last scenario in our simulations. We were mainly interested in the range of virus specific parameters that maximize the chance of tumor elimination. Using data from prior work on in vivo tumor control with the same virus \[[@pcbi.1006773.ref008]--[@pcbi.1006773.ref011]\], we fixed the replication and natural death rates of normal and cancer cells and varied the parameters for virus replication and virus induced cell death rates across a wide range of values (*λ*~3~: 0 − 100; *δ*~3~: 0 − 15). A total of 14,000 simulations were performed with each simulation continuing until either the tumor cell population was eliminated or 1000 days had passed, whichever came first. We report the cumulative results of these simulations in [Fig 9](#pcbi.1006773.g009){ref-type="fig"}. As can be seen, the results are qualitatively different. The mean field solution predicts that most of the time, the 3 population equilibrium is the most likely outcome. In 2 dimensions, the parameter range where cure of the tumor is possible is wider compared both to the mean field estimate and the 3D simulations. Moreover, in 2D there is very little difference in output between the regular grid lattice and the Voronoi lattice likely due to the fact that the number of nearest neighbors is similar (4 versus 6 respectively). However, the probability of a cure is less for a Voronoi type network in 3D compared to a regular lattice, although the Voronoi lattice increases the chances for the co-existence of all three populations with less chance of the tumor taking (failed therapy) over compared to the 3D regular lattice. This is likely due to the higher number of neighbors that each cell possesses which increases the chance for infection. All simulations agree that the ideal virus should replicate rapidly (high *λ*) but kill cells slowly (low *δ*). Indeed, the model shows that there is a wider tolerance for replication rates and less so for the death rates of infected cells. Tumor eradication is more likely on a 2D surface compared to a 3D object for any set of parameters even though in 3D the number of cell neighbors is higher and equilibrium is reached faster, implying faster dynamics of virus spread. This is compatible with our in vitro observations and illustrates some of the intrinsic barriers to virus spread imposed by a 3D architecture versus a surface. {#pcbi.1006773.g009} Discussion {#sec008} ========== Tumor therapy with replication-competent viruses is an exciting novel approach to cancer therapy in which the target to be eliminated amplifies the agent responsible for its own death. Perhaps the only other member of this paradigm is cancer immunotherapy with chimeric antigen receptor T cells that are stimulated to replicate by engagement of cell surface antigens expressed by tumor cells. However, for successful tumor control with viruses, the latter have to establish foci of infection within the tumor, replicate to amplify the virus population and spread across the tumor. At the same time, the virus has to evade as much as possible the immune response that can neutralize the virus population or eliminate infected cells which would halt virus propagation. The outcome of such therapy is highly dependent on the dynamic interactions between the various populations of cells \[[@pcbi.1006773.ref005]--[@pcbi.1006773.ref007], [@pcbi.1006773.ref023]--[@pcbi.1006773.ref026]\]. However, as our results show, the outcome is also quite sensitive to the architecture of the tumor since there may be several barriers to the spread of the oncolytic virus. These barriers may be physical or chemical in nature \[[@pcbi.1006773.ref013], [@pcbi.1006773.ref027]\]. It has been argued that modeling with differential equations that provide a mean field approximation may be good enough to optimize therapy with these viruses and that such equations can capture well the dynamics without the need to consider space explicitly \[[@pcbi.1006773.ref026]\]. We have addressed the problems with this postulate in our work. Initially we provided a detailed analysis of tumor cell growth and virus spread in vitro both in 2D and 3D coupled with an analysis of the rate of replication of cells as well as the number of neighboring cells in a given environment. Our modeling approach differs from other publications \[[@pcbi.1006773.ref017]\] since we used this data to generate realistic computational models of tumor cell growth and virus spread. Subsequently, we analyzed through simulations many potential scenarios that consider two critical virus parameters: its rate of replication and the rate at which it kills cells. These two parameters have been repeatedly shown to be important for the outcome of virotherapy \[[@pcbi.1006773.ref006], [@pcbi.1006773.ref008]--[@pcbi.1006773.ref010], [@pcbi.1006773.ref012], [@pcbi.1006773.ref013], [@pcbi.1006773.ref017], [@pcbi.1006773.ref018], [@pcbi.1006773.ref028]\]. The wide spectrum of viruses available for oncolytic therapy have different kinetics of spread or can be engineered to alter their kinetics of replication or cell killing \[[@pcbi.1006773.ref001]\]. Our in vitro studies show that the same virus will kill cells more slowly in a 3D environment compared to the 2D setting, despite the fact that in 3D the average number of cells in a neighborhood is higher. As a result, in 3D, for the same set of parameters, the probability of tumor elimination is lower compared to the mean field approximation and also less than in a 2D environment despite the system reaching equilibrium by at least an order of magnitude faster. This fits well with all in vitro studies where the virus is highly efficient in killing tumor cells growing in the 2D plane but less so in a 3D environment whether in vitro (spheroids) or in vivo as tumor xenografts \[[@pcbi.1006773.ref008]--[@pcbi.1006773.ref012], [@pcbi.1006773.ref029]\]. There are several possible explanations for the difference in outcome for tumor control in 2D versus 3D. While in 2D virtually all the tumor population is likely accessible to the virus that spreads at a fast rate, the same cannot be said for the 3D scenario where geometry not only makes some areas of the tumor quite distant from the infected foci but the virus also physically appears to spread at a slower rate even between adjacent cells. Moreover, one can envisage scenarios in 3D where a part of the tumor loses contact with the main tumor that is being infected. This will impose even greater spatial restrictions on the spread of the virus and reduces the probability of tumor control even further. However, in 3D the equilibrium is reached faster due to the higher number of contacts between cells. It is not difficult to see why the mean field model will overestimate the effect of therapy, since this approach assumes the presence of a well-mixed population based on mass action kinetics, thus rendering tumor cells accessible to viruses at all times. However, in a 3D structure such as a tumor, not all cells are at the same risk of being infected due to their spatial proximity, or lack thereof, to infected foci. Any part of the tumor that loses contact with infected foci will result in tumor regrowth unless virus can diffuse and establish a new infection there--something that appears to be unlikely with the current scenarios \[[@pcbi.1006773.ref027]\]. Moreover, we have observed from in vivo studies that many cells in proximity to a highly infected focus never become infected and the size of infected foci can be quite variable (Kemler et al, submitted). The biological and physical bases for these observations require further analysis. Our work complements that of Wodarz et al \[[@pcbi.1006773.ref007], [@pcbi.1006773.ref019]\] who studied spread of an adenovirus in a monolayer and showed the importance of local interactions on the spread of the virus. Their work expanded on the importance of initial conditions and the potential impact of an antiviral state due to interferon production. It is important to note that 293T cells used in their experiments are not derived from a tumor and so are likely to respond to interferon production. In contrast, we used cell lines that are derived from tumors that generally do not mount a robust immune response against measles virus. We also extended our in vitro studies and computational modeling to 3D where the number of neighbors and the spatial structures become more complex. Our results show that the number of neighbors surrounding a cell can facilitate spread of the virus and leads to the three population equilibrium more often and more quickly (compare Voronoi network with grid lattice in [Fig 9](#pcbi.1006773.g009){ref-type="fig"}). However, in the presence of an immune response, we hypothesize that the outcome could be worse for a Voronoi type lattice compared to a regular lattice since the latter has a higher probability of a cure. The simulations also show that the mean field solution generally provides a more optimistic view of the outcome compared to the Voronoi type architecture that seems to exist in spheroids. However, the higher number of neighbors in a Voronoi network is associated with failure of therapy less often compared to a regular grid lattice at least in theory. Our results highlight the need for spatially explicit modeling to accurately capture the dynamics of tumor virotherapy. We also show the problems that arise from the introduction of a third dimension into such a model--the probability of a cure decreases significantly when the virus is used in an attempt to cure a 3D tumor compared to cells in the 2D plane. Materials and models {#sec009} ==================== Cell lines {#sec010} ---------- The human fibrosarcoma cell line HT1080 was obtained from ATCC and grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and maintained at 37°C with 5% CO~2~. 293T cells were maintained in DMEM with 10% FBS. The human cell line 293-3-46 was maintained in DMEM with 10% FBS and geneticin (1.2mg/ml) while Vero cells were maintained in DMEM with 5% FBS. Lentiviral vectors expressing fluorescent proteins {#sec011} -------------------------------------------------- PCR products containing the yellow fluorescent protein (YFP), enhanced blue fluorescent protein (eBFP), and the tdTomato genes were generated using Roche Fast-Start High Fidelity PCR kit using pCAG-YFP, CFP, pCSCMV:tdTomato (Addgene) as template DNA. The primers (Forward: G[GGATCC]{.ul}ACGCCACCATGGTGAGCAAGGGCG and reverse: GAG[GCGGCCGC]{.ul}AGTTTACTTGTACAGCTCGTCCATGCC) had restriction sites for *BamHI* and *NotI* to facilitate cloning in the lentiviral vector backbone \[[@pcbi.1006773.ref030]\]. PCR products were cloned into pHR\`CMV-eGFP-SIN (a gift of Dr Y. Ikeda, Mayo Clinic, Rochester) after the excision of GFP via digestion with *BamHI* and *NotI*. The resulting constructs were verified by restriction digestion and sequencing. Lentiviral particles containing the respective reporter genes were generated via transfection of 293T cells with pMD.G, pΔCMV.8.91, and the plasmid encoding the vector genome with the fluorophore as previously described \[[@pcbi.1006773.ref030]\]. Vector containing supernatants were harvested after 72 hours, filtered (0.42μm) and used to transduce HT1080 cells. Cells expressing the reporter gene were sorted by flow cytometry and plated as single cells into 96 well plates in DMEM with 10% FBS and expanded as clones for further studies. Recombinant measles virus generation {#sec012} ------------------------------------ In order to generate recombinant replication competent measles viruses expressing different fluorescent reporter genes, PCR products containing the fluorophores eBFP, YFP, and tdTomato were generated using pCAG template DNA (Addgene). PCR primers had the *MluI* and *AatII* restriction sites (underlined) in their flanking region to facilitate cloning (Forward: G[ACGCGT]{.ul}ACGCCACCATG GTGAGCAAGGGCG and reverse: GAG[ACGTC]{.ul}AGTTTACTTGTACAGCTCGTC CATGCC. The PCR products were gel purified, digested and subsequently ligated into pCR2.1Topo, expanded in TOP10 cells (Invitrogen), and inserts excised with *MluI* and *AatII* digestion followed by ligation into p(+)MVeGFP(N) that was digested with the same enzymes to remove the eGFP gene. Viruses were rescued by transfection of 293-3-46 cells together with pEMC-La followed by overlay on Vero cells as previously described \[[@pcbi.1006773.ref004], [@pcbi.1006773.ref031]\]. Rescue of the recombinant viruses was inferred from the presence of syncytia and fluorophore detection under ultraviolet light. The recombinant viruses were expanded by infection of Vero cells. Cell associated viruses were freed by freeze thawing of the cells three times in liquid nitrogen followed by filtration. The viral titers (50% infectious virus dose, TCID~50~/ml) were determined using the Spearman and Karber method as previously described \[[@pcbi.1006773.ref004], [@pcbi.1006773.ref031]\]. All viruses were stored at -80°C until they were used. Tumor spheroid generation {#sec013} ------------------------- HT1080 spheroids were grown on either Matrigel coated glass bottom 6 well plates or poly-HEMA coated round bottom plates to prevent cell attachment. For Matrigel coated wells, media, tips, and glass bottom plates were cooled at 4°C and 200μl Matrigel added. Matrigel was allowed to solidify for 15 minutes. HT1080 cells were washed 3 times with phosphate buffered saline (PBS) and dislodged by trypsin, counted and overlaid at various concentrations into 2ml DMEM with 10%FBS and 2% Matrigel. The media were freshly replaced every 3--4 days and cells were imaged with a multiphoton microscope (Olympus). Spheroids were infected using measles viruses encoding various fluorophores in 2 mL Opti-MEM for 2 hours at 37°C at an MOI of 1.0. In vitro imaging {#sec014} ---------------- HT1080-tdTomato cells were plated in 6 well plates and 24 hours later infected with MVeGFP at an MOI of 1.0 Tumor spheroids from the same cell line expressing eCFP were produced as above and infected with MV-tdTomato. Starting twenty-four hours post infection, the cells were imaged in Z stacks every 30 minutes over the course of a week using an Olympus multiphoton microscope. Digital images were captured for subsequent analysis. Pattern analysis {#sec015} ---------------- Average pixel area per cell: The average pixel area of a cell was determined by having two independent scientists counting the number of cells in a given field of view with a fixed color pixel threshold and correlated this with the phase contrast images of the cells. The total pixel area was divided by the number of cells to determine the average pixel area per cell. Serial images of in vitro cell growth and virus spread were digitally analyzed using the established cell area parameters and the output was converted back into number of cells. Voronoi tessellation: Digital images from the in vitro experiments with cells growing in the 2D-plane or in 3D spheroids were analyzed using MatLab to generate Voronoi tessellation analysis of nearest neighbors in 2D and 3D. Mathematical modeling and data fitting {#sec016} -------------------------------------- We developed a 'mean field' mathematical model for tumor growth and viral infection of tumor cells as follows: $$\frac{du_{N}}{dt} = \lambda_{N}u_{N}\left( {1 - u_{N} - u_{C} - u_{V}} \right) - \delta_{N}u_{N}$$ $$\frac{du_{C}}{dt} = \lambda_{C}u_{C}\left( {1 - u_{N} - u_{C} - u_{V}} \right) - \delta_{C}u_{C} - \lambda_{V}u_{C}u_{V}$$ $$\frac{du_{V}}{dt} = - \delta_{V}u_{V} + \lambda_{V}u_{C}u_{V}$$ In the model, *u*~*i*~ represents the various cellular fractions with *N* representing normal cells, *C* cancer cells and *V* the infected cancer cells. *λ*~*i*~ represents the proliferation and *δ*~*i*~ the death rates of the respective populations. The model assumes mass action kinetics. The model was fitted to data from in vitro studies using the purpose built simplex induction hybrid (SIH) program \[[@pcbi.1006773.ref032]\] and the results of the fits displayed as a heat plot (see results). The goodness of fit was determined using the chi square method. The relative parameters for virus infected cells and tumor cells were used to inform the computer simulations. Computational model {#sec017} ------------------- The model we developed can run simulations of cell populations and infection both in 2 and 3 dimensions and population growth can be either on a lattice structure (regular) or a Voronoi network with a variable number of neighboring cells \[[@pcbi.1006773.ref018]\]. The input for the network is described by a list of adjacencies for each node obtained by analysis of the imaging obtained from in vitro experiments. The simulator itself has no dimensionality and therefore, it can run simulations in two, three or higher dimensions. The number of neighbors for each node and their location can vary as observed in vitro. Routines embedded in the program enable modification of the state of the network to simulate the addition of the virus that will spread within the cell population. Each node in the network is occupied at most by one cell. Three types of cells are possible: normal cells, cancer cells and infected cancer cells. A node without a cell is empty. When a normal or cancer cell proliferates, the new cell generated has to occupy a neighboring empty node while infected cells can target only nodes occupied by a cancer cell since the virus is tumor cell specific \[[@pcbi.1006773.ref033]\] and the virus spreads from cell to cell \[[@pcbi.1006773.ref018], [@pcbi.1006773.ref021], [@pcbi.1006773.ref031]\]. Each cell type has a node type that it considers as a replication target. Empty nodes are proliferation targets for normal and cancer cells while a cancer cell node is a proliferation target for infected cells. The growth and death rates of normal and cancer cells as well as infected cells can be varied as well as the time when the virus is administered. The virus infection parameters can also be specified. Event arrivals follow a Poisson process with the time to the next event being exponentially distributed. Furthermore, the model assumes that cell proliferation and death are independent events and do not depend on the prior state of the network. To initiate the infection, the program determines the coordinates of all cancer cells and identifies the cancer cell that is closest to the center. The simulator has 4 infection routines that can be used to specific which individual nodes are infected at the start of the simulation. (i) *Random* selects cells at random within the tumor population until the pre-specified fraction of cells are infected. (ii) *Center* selects the cancer cell closest to the center of the tumor and this cell is infected followed by its neighbors and neighbors' neighbors are infected until the required fraction of infected cells is reached. (iii) *Multinode* selects the tumor cells closest to the center for infection and the infection spreads from this focus by generating a line in a random direction that passes through the infected node. Nodes along the line are visited and if they are cancer cells infected with a determined probability. The process continues until normal cells are reached which cannot be infected. (iv) *Perimeter* determines the center of the tumor and the distance of all nodes from the center. Cancer cells occupying the nodes furthest from the center are infected until the pre-specified fraction of cancer cells are infected. The dynamics of normal and uninfected cancer cells continue with the same parameters once the infection is introduced. A simulation starts by reading a set of network files that specify the network structure, node locations and cell types (optional). If no cell type is included, normal cells are assumed. The program has an optional equalization period until the population stabilizes. Cancer cells are then introduced and the simulation allowed to run until the virus is introduced. The simulation is continued until either the cancer or virus population goes extinct or a pre-specified time is reached. The percentage of infected cells at the time of virus administration is an input variable. Initial infection is assumed to occur very rapidly. In all simulations, time is defined by the rate of replication of cells (the generation time). [Fig 10](#pcbi.1006773.g010){ref-type="fig"} presents a schematic of the process. A copy of the code is available at <http://hdl.handle.net/11299/174710>. A total of 7,000 runs were performed for each set of spatially explicit simulations (e.g. 2D grid, 2D Voronoi) starting with similar initial conditions but varying the parameters related to the rate of virus spread (*λ*~3~ = 0 − 100) and virus induced cell death rate (*δ*~3~ = 0 − 15). {#pcbi.1006773.g010} [^1]: The authors have declared that no competing interests exist.

<!DOCTYPE html> <html> <head> <title>MathJax Example Page</title> <!-- Copyright (c) 2012-2017 The MathJax Consortium --> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8" /> <meta name="viewport" content="width=device-width, initial-scale=1"> <style> li {margin-top: .2em} </style> </head> <body> <h1>MathJax Example Pages</h1> View the page source for any of these examples to see how they work. <ul> <li><a href="sample-tex.html">Page using TeX notation</a></li> <li><a href="sample-mml.html">Page using MathML notation</a></li> <li><a href="sample-asciimath.html">Page using AsciiMath notation</a></li> <li><a href="sample.html">Page included several examples TeX equations</a></li> <li><a href="sample-eqnum.html">Page of TeX equations with automatic numbering</a></li> <li><a href="sample-eqrefs.html">Page of TeX equations with equation references</a></li> <p> <li><a href="sample-macros.html">Example of defining TeX macros</a></li> <li><a href="sample-autoload.html">Defining macros to autoload the extensions in which they are implemented</a></li> <p> <li><a href="sample-all-at-once.html">Example of waiting until all the math is typeset before displaying the page (avoids "flicker")</a></li> <p> <li><a href="sample-dynamic-steps.html">Showing an equation one step at a time</a></li> <li><a href="sample-dynamic.html">Display an equation typed in by a user</a></li> <li><a href="sample-dynamic-2.html">Preview text containing math typed in by a user</a></li> <p> <li><a href="sample-loader.html">Loading MathJax into a page after it is loaded</a></li> <li><a href="sample-loader-config.html">Loading MathJax dynamically with in-line configuration</a></li> <p> <li><a href="sample-signals.html">Page showing MathJax signals during page processing</a></li> </ul> </body> </html>

Could you send me copies of the Excel reports you want us to modify. Thanks. -----Original Message----- From: Griffith, John Sent: Wednesday, January 31, 2001 12:33 PM To: Wong, Jeremy Cc: Maggi, Mike; McLaughlin, Errol Subject: Predictive Greeks Jeremy, Each day, we receive a report that shows the movement of the position's gamma with a change in the underlying (a gamma slide). We would like to see how difficult it would be to see the same with vega (a vega slide). Also, there is a report that shows totals for all the greeks by month. Could you put a total line at the bottom of this report? Please let me know of the difficulty of these changes. Thanks. John x. 36247

Opinion filed August 3, 2017 In The Eleventh Court of Appeals ___________ No. 11-17-00182-CR ___________ JOSHUA WALTER GOSSON, Appellant V. THE STATE OF TEXAS, Appellee On Appeal from the 42nd District Court Taylor County, Texas Trial Court Cause No. 27272A MEMORANDUM OPINION Joshua Walter Gosson, Appellant, has filed an untimely pro se notice of appeal from a conviction for the offense of possession of methamphetamine. We dismiss the appeal. The documents on file in this case indicate that Appellant’s sentence was imposed on May 10, 2017, and that his notice of appeal was filed in the district clerk’s office on June 29, 2017. When the appeal was filed in this court, we notified Appellant by letter that the notice of appeal appeared to be untimely and that the appeal may be dismissed for want of jurisdiction. We also noted that the trial court had certified this was a plea-bargain case and that Appellant had waived his right to appeal. We requested that Appellant respond to our letter and show grounds to continue. Appellant has not filed a response. Pursuant to TEX. R. APP. P. 26.2(a), a notice of appeal is due to be filed either (1) within thirty days after the date that sentence is imposed in open court or (2) if the defendant timely files a motion for new trial, within ninety days after the date that sentence is imposed in open court. A notice of appeal must be in writing and filed with the clerk of the trial court. TEX. R. APP. P. 25.2(c)(1). The documents on file in this court reflect that Appellant did not file a motion for new trial and that Appellant’s notice of appeal was filed with the clerk of the trial court fifty days after sentence was imposed. The notice of appeal was, therefore, untimely. Absent a timely filed notice of appeal or the granting of a timely motion for extension of time, we do not have jurisdiction to entertain this appeal. Slaton v. State, 981 S.W.2d 208, 210 (Tex. Crim. App. 1998); Olivo v. State, 918 S.W.2d 519, 522–23 (Tex. Crim. App. 1996); Rodarte v. State, 860 S.W.2d 108, 110 (Tex. Crim. App. 1993). Neither a notice of appeal nor a motion for extension were filed within the fifteen-day period permitted by TEX. R. APP. P. 26.3. Moreover, the trial court’s certification reflects that this is a plea-bargain case and that Appellant has no right of appeal. Thus, even if Appellant had timely perfected an appeal, the appeal would have been prohibited by TEX. R. APP. P. 25.2, which provides that an appellate court must dismiss an appeal without further action when there is no certification showing that the defendant has the right of appeal. 2 TEX. R. APP. P. 25.2(d); Chavez v. State, 183 S.W.3d 675, 680 (Tex. Crim. App. 2006); see Dears v. State, 154 S.W.3d 610, 613–14 (Tex. Crim. App. 2005). This appeal is dismissed for want of jurisdiction. PER CURIAM August 3, 2017 Do not publish. See TEX. R. APP. P. 47.2(b). Panel consists of: Wright, C.J., Willson, J., and Bailey, J. 3 

Mr. Donny Mark Shelnutt Mr. Donny Mark Shelnutt, age 49, of Franklin, Georgia, passed away at his home on Thursday, May 10, 2013. Funeral services for Mr. Shelnutt were conducted on Monday, May 13 at 4 p.m. from the Tom Stutts and Son Funeral Home in Franklin, Georgia, with the Reverends Lynn Janney officiating, assisted by Mike Powell. The interment followed in the Franklin City Cemetery. Music was provided by Juanita Shelnutt and Alecia Runnels. Those serving as pallbearers were Christopher Shelnutt, Scott Shelnutt, Corbey Shelnutt, Corey Shelnutt, Codey Shelnutt and Eric Slawson. Mr. Shelnutt was born in Heard County, Georgia on April 6, 1964, the son of Janice Arrington Shelnutt and Terry Lamar Shelnutt. He was a Christian by faith, and was employed by the City of Grantville as a Power Line Technician. He served his country honorably in the United States Army National Guard. He loved hunting and fishing. He was a loving husband, father, grandfather, friend to all, and benefactor to many in need. He will be greatly missed by all who knew him. He is survived by his wife, Tammy Shelnutt; daughter and son-in-law, Stephanie and Timmy Powell; mother and father, Janice and Terry Shelnutt; two brothers, Scott and Jaunita Shelnutt and Corbey and Connie Shelnutt; the pride and joy of his life, his grandsons, Nicholas and Timothy Powell; and many adoring nieces and nephews, all of Franklin, Georgia. The Tom Stutts and Son Funeral Home of Franklin, Georgia was in charge of arrangements.

4. The Cat Secret ''WE ARE GOOD HUMANS'' Luna screamed. All the cats froze ''Good humans?,-What?'' "You heard me ,we're good humans .''''.Why should we trust you?" The leader sneered. "I have a cat,and- " Hermione began.Before she could say anything else, Crookshanks ran in. "Hermione," "YOU CAN TALK?!???!" Hermione screamed. "Yes of course I can talk-" "Oh my," Luna said. "That is why we don't like humans, we are afraid that they will tell everyone that we can talk!" The leader explained. "I have a good idea,said Hermione,We can do the Unbreakable Vow that we won't tell.Deal?" " Yes,deal." And they shook hands/paws.

Poor Balance May Signal Higher Risk of Dementia A new study analyzed the association between four different measures of physical performance and the risk of dementia for great-grandparents. The researchers, from the University of California at Irvine, observed a strong link between dementia risk and poor performance on the standing balance test. Additionally, a small association was also found between developing dementia and performing poorly on the four-meter walk and handgrip tests. The study included nearly 600 adults, aged 90 and older. In addition to the physical performance tests, the participants underwent physical and neurological exams and cognitive tests. During a follow-up period of two-and-a-half years, 40 percent developed dementia. Since balance and walking require complex brain activity, testing these functions may help predict who might be most at risk for developing dementia.

Q: QuickBlox custom table -- Create relation and getting related records on iOS How do I create relation between two custom tables with the iOS SDK? Do I just set the parentID on QBCOCustomObject to create it? On the REST doc there is a way to get multiple related records, how do I do that with Quickblox iOS sdk? A: There is parentID field. How it works: for example you have 2 entities: Movies & Comments. Each comment has parentID=movieID. If you will delete this Movie - all Comments will be deleted also. To get related records just use extendedRequest param NSMutableDictionary *getRequest = [NSMutableDictionary dictionary]; [getRequest setObject:@"31212412a1269123" forKey:@"_parent_id"]; [QBCustomObjects objectsWithClassName:@"Comment" extendedRequest:getRequest delegate:self];

Q: How to escape regex in java in order to make them work properly? Actually I am not an expert in regex ,I've always copied and pasted them... Right now I am finishing an android application and I needed to check wether the input string from an autocompleteTextView was matching the multiple and most common known forms of url and so I found out this regex: /^(https?:\/\/)?([\da-z\.-]+)\.([a-z\.]{2,6})([\/\w \.-]*)*\/?$/ , that after escaping it like this: /^(https?:\\/\\/)?([\\da-z\\.-]+)\\.([a-z\\.]{2,6})([\\/\\w \\.-]*)*\\/?$/ was not working as it should… Am I escaping it wrong, or it's something else ? A: Your regex looks like it was written for JavaScript. Since Java doesn't support regex literals (e.g. /regex/), you have to write yours as a Java string literal. You're halfway there already with the double escapes; now you need to replace the regex delimiters with quotes: "^(https?:\\/\\/)?([\\da-z\\.-]+)\\.([a-z\\.]{2,6})([\\/\\w \\.-]*)*\\/?$" That should work fine, but many of those escapes aren't needed. Specifically, the slashes (/) aren't special because you're not using them as delimiters any more, and the dot isn't special when it's in a character class (i.e., inside the square brackets). Here's the tidied version: "^(https?://)?([\\da-z.-]+)\\.([a-z.]{2,6})([/\\w .-]*)*/?$" Note that I'm only talking about the syntax of your regex, not its correctness. Validating URL's with a regex has been the subject of many heated discussions, and I don't want to start another one.

The Mac Sale Offers 10 Amazing Apps for $49.99 There are many people that get excited every year when MacHeist begins to offer their excellent software bundles. Unfortunately, due to this there are also many people that commonly overlook so many of the other great offers online. If you are a Mac user interested in getting some incredible deals on software, you definitely want to take a look at The Mac Sale. You have until the 15th of March to take advantage of the bundle that includes $500 worth of apps for $49.99. Below is information about the 10 apps included in the package.

Warning: session_is_registered() [function.session-is-registered]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Deprecated: Function session_is_registered() is deprecated in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Warning: session_register() [function.session-register]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 74 Deprecated: Function session_register() is deprecated in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 74 Warning: session_is_registered() [function.session-is-registered]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Deprecated: Function session_is_registered() is deprecated in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Warning: session_register() [function.session-register]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 74 Deprecated: Function session_register() is deprecated in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 74 Warning: session_is_registered() [function.session-is-registered]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Deprecated: Function session_is_registered() is deprecated in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Warning: session_is_registered() [function.session-is-registered]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Deprecated: Function session_is_registered() is deprecated in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Warning: session_is_registered() [function.session-is-registered]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Deprecated: Function session_is_registered() is deprecated in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Warning: session_is_registered() [function.session-is-registered]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Deprecated: Function session_is_registered() is deprecated in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Warning: session_register() [function.session-register]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 74 Deprecated: Function session_register() is deprecated in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 74 Warning: session_register() [function.session-register]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 74 Deprecated: Function session_register() is deprecated in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 74 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: eregi() [function.eregi]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Deprecated: Function eregi() is deprecated in /home/medexa5/public_html/oscommerce1/includes/classes/language.php on line 87 Warning: date() [function.date]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/languages/english.php on line 318 Warning: date() [function.date]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/languages/english.php on line 318 Warning: session_is_registered() [function.session-is-registered]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Deprecated: Function session_is_registered() is deprecated in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Warning: session_is_registered() [function.session-is-registered]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Deprecated: Function session_is_registered() is deprecated in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Warning: session_register() [function.session-register]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 74 Deprecated: Function session_register() is deprecated in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 74 Warning: session_is_registered() [function.session-is-registered]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Deprecated: Function session_is_registered() is deprecated in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Warning: session_register() [function.session-register]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 74 Deprecated: Function session_register() is deprecated in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 74 Warning: session_is_registered() [function.session-is-registered]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Deprecated: Function session_is_registered() is deprecated in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Warning: session_is_registered() [function.session-is-registered]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Deprecated: Function session_is_registered() is deprecated in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81Medworks Warning: session_is_registered() [function.session-is-registered]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Warning: session_is_registered() [function.session-is-registered]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Deprecated: Function session_is_registered() is deprecated in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Warning: session_is_registered() [function.session-is-registered]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Deprecated: Function session_is_registered() is deprecated in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 The green board you see there is a square which is 3.9 inches on a side. Click on the picture to see it big, and use the left and right arrow keys to move around. First of all, I want to make 3 things clear. 1. You are not buying the clock in the picture. That one is my demonstration piece. It took me too long to solder together for me to throw around that with a 20 or even 30 dollar pricetag. That would be half minimum wage or less. It took long enough just to get the components together to make the kit.2. You are buying a kit. You get 91 LEDs (one spare), a programmed microcontroller, resistors, capacitors, a crystal, a speaker, etcetera, a circuit board, and an information sheet on specifics you'll need to get it right. This does NOT include a power supply. You need to give it 6.3 to 12 volts DC from somewhere. You also need a soldering iron and solder.3. The kit does not contain ultra-bright brightly colored LEDs as seen in the picture. You get generic red and green LEDs. Just like the 8 pink tinted LEDs you see in a row at the bottom of the clock. Those LEDs by the way indicate which parameter you are setting. So you have 7 LEDs for the days of the week, 60 for the ring of seconds/minutes, 12 for the hours, 1 each for AM and PM (tell me if you only want one for AM or one for PM rather than a LED for each of them - you must decide beforehand whether that LED will be there), 1 to let you know if the alarm is set to go off (but isn't necessarily going off right now), and 8 to let you know what you are setting, when you are setting it. Those pink and green tinted LEDs that come standard with this kit are also sold on their own on the website here. By the way, there are 2 completely different versions of the program, one which controls a "AM" LED which is on in the morning and a "PM" LED which is on in the evening, and a different version which controls only the PM LED, which is off in the morning. If you only want one LED to denote AM/PM, you can't use the version that controls them both, because it will turn on other LEDs when it tries to turn on the AM LED which won't be there. Please tell me which version you want or I will choose for you. THIS particular version of the board can in fact handle either surface mount chips or DIP chips. I have surface mount PIC16C54 chips and DIP ones and I may give you one or the other. Almost certainly it's going to be surface mount, unlike the one in the picture. But it's the big kind of surface mount. 1/20 inch between pins. In the picture, you can see I actually have a decoupling capacitor soldered to it. You should have a decoupling capacitor between the 4th and 5th pins down on the left side on ONE of the pads. On retrospect, it is not so aesthetic, where I put it. I should have put it on the backside. The DIP soldering pad goes from the top side to the back side, and the SOIC one only exists on the front side, but the pinout is the same. If you have a preference for a DIP chip or a SOIC chip since either can be used, but with that option, you are more at my mercy, whether availability allows. Probably it will be SOIC but if I have any made up with DIP and you want them, I'll let you have it. A demonstration of the version of this clock with the alarm can be seen here (make sure to be patient when downloading this, and make sure to have some kind of pop-up ad killer in place: mediafire will definitely zap you if you don't): To see a demonstration of not this version of the clock but the version without the alarm (not the kind for sale here) which also flashes all its LEDs 11 times per second (also unlike the kind for sale here), watch this: It is not only a clock but a calendar too. You give it the year modulo 4, the month, the day in month, the day in week, hour, minute, second. Press one of the 2 buttons to get it to show you the date (the 5th picture shows this - it displays the date March 1 - today as of when I wrote this), where the 12 hours represent the month and the minutes/seconds represents the day in the month. The ring of 60 LEDs shows you the minutes AND the seconds. The seconds flash. Also they advance one per second. It also automatically adjusts for daylight saving time as it is right now in the US. So beware if you're in a place that doesn't do daylight/standard transitions or does it at a different time. The alarm can be set to any time down to the second, and can be enabled for any combination of days of the week. So if you want it to just go off on weekdays you can do that. Or if you want it to only be on Saturday, you can do that. The alarm is set by holding down the "show date" button and then pressing the set button. If you just press the set button, it sets the clock's real time, not the alarm time. Please feel free to check out our other electronic items at medexamtools.com/diodes.htm. These can be added into your order for combined shipping as well (the shopping cart system will do it automatically). Warning: date() [function.date]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/product_info.php on line 189 Warning: date() [function.date]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/product_info.php on line 189 Warning: mktime() [function.mktime]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/general.php on line 564 Warning: mktime() [function.mktime]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/general.php on line 564 Warning: strftime() [function.strftime]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/general.php on line 564 Warning: strftime() [function.strftime]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/general.php on line 564 This product was added to our catalog on Thursday 23 January, 2014. Warning: session_is_registered() [function.session-is-registered]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Deprecated: Function session_is_registered() is deprecated in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Warning: session_is_registered() [function.session-is-registered]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Deprecated: Function session_is_registered() is deprecated in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Notifications Warning: session_is_registered() [function.session-is-registered]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Deprecated: Function session_is_registered() is deprecated in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 81 Warning: mktime() [function.mktime]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/counter.php on line 27 Warning: mktime() [function.mktime]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/counter.php on line 27 Warning: strftime() [function.strftime]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/counter.php on line 27 Warning: strftime() [function.strftime]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/counter.php on line 27 Warning: strftime() [function.strftime]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/footer.php on line 17 Warning: strftime() [function.strftime]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/footer.php on line 17 Thursday 24 May, 2018 Warning: session_write_close() [function.session-write-close]: It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Los_Angeles' for 'PDT/-7.0/DST' instead in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 106 Warning: session_write_close() [function.session-write-close]: Your script possibly relies on a session side-effect which existed until PHP 4.2.3. Please be advised that the session extension does not consider global variables as a source of data, unless register_globals is enabled. You can disable this functionality and this warning by setting session.bug_compat_42 or session.bug_compat_warn to off, respectively in /home/medexa5/public_html/oscommerce1/includes/functions/sessions.php on line 106

Q: How to mock the same method multiple times use mockito I have a method that needs to be called multiple times, and I can return the same result in the test case, I invoke when use for loop, but is there more simple way to do this? val ONE_DAY_FORMAT: SimpleDateFormat = SimpleDateFormat("yyyy-MM-dd") val tempCalendar = Calendar.getInstance() for (i in (0..15)) { `when`(accountingDao.sumOfDay(ONE_DAY_FORMAT.format(tempCalendar.time))) .thenReturn(100.0f) tempCalendar.add(Calendar.DAY_OF_YEAR, -1) } A: Normally when the set-up is more complicated, the doAnswer strategy would be used: Mockito.doAnswer(new Answer<Float>() { @Override public Float answer(InvocationOnMock invocation) throws Throwable { String argument = (String)invocation.getArgument(0); if(supportedDates.contains(argument)){ return 100.00f; }else{ return null; } } }).when(accountingDao.sumOfDay(any(String.class))); So you basically catch the input param and then decide based on its value what should be returned dynamically.

HOMEBUILDLIFE TUMBLR WGSN Monday, 6 August 2012 South Korean designer Minwoo Lee created this anthropomorphic humidifier with a sci-fi look. Called Alianoid, the device emits steam from two large holes placed on the side of its head. It is possible to control intensity and check how much water is left through a user-friendly control panel in the base. Subscribers can read our full report on design-led air purifiers and humidifiers here.

Typically, when a client computer system requests content from a server, whether over the Internet or, in some instances, over a local and/or wide area network, the request is intercepted at one or more intermediary devices, each of which may alter the request in some way, according to rules installed on the intermediary device. The intent of these rules, and their embodiment, are commonly known as policies. Policies thus define behaviors of the intermediary devices in connection with the requests. One common form of intermediary device is a cache: a device that maintains copies of requested information (e.g., web pages and the like) so that multiple requests for the same information can be satisfied at the cache. When requests for information are satisfied at a cache, server devices need not receive the requests, process them, and retransmit the same information over a communication channel that links the client devices and the server devices. In the context of typical web browsing, for example, the server devices can be web servers, the client devices can be web clients (e.g. browsers running on personal computers and the like), the communication channel can be an Internet Protocol (IP) network such as the Internet, and the requested information can be web pages and or objects (e.g. images, videos, etc.). Not surprisingly, in light of the above, caches are often instantiated with or operated according to policies that affect their behaviors in the context of the requests received at the caches and the sites for which the requests are destined. In particular, caches generally are provided with caching polices. These caching polices are sometimes written according to well-established and published guidelines for how certain content is to be cached (e.g., RFC 2616 promulgated by the Internet Engineering Task Force), but such policies do not always work well in the context of certain web sites. For example, with some web sites, specially defined policies may be required in order to dictate caching behavior that optimizes bandwidth savings. Often this may be due to the web site designers not considering good cache efficiencies when designing their sites, but in other cases it may be due to the peculiarities of the content hosted at the site, the manner in which the content is stored at the servers, the physical or logical arrangements of the servers hosting the content of interest, or other factors. In the past, in order to deal with these problematic (from a cache efficiency point of vim) web sites, cache providers would have to develop custom solutions or “fixes” as individual customers (e.g., Internet service providers, enterprise network managers, and the like) reported problems. These custom solutions were often only developed after tedious review of voluminous log files obtained from the cache devices and were then distributed somewhat haphazardly as custom configuration files and the like to the cache providers' individual customers. Such distribution occurred through technical briefs, e-mail transmissions or postings on forums, and it was up to the customers to use and install them or not. This of course required knowledgeable customers and there was no guarantee that installing such a custom configuration file would even cure the problem that was initially observed. Thus, each caching problem was treated as a separate instance, with separate and disparate solutions being developed by researchers and others working in isolation from one another.

Cynics Corner Season Six Review Over at the Cynics Corner, David E. Sluss has put up his review of Voyager's sixth season. Awarding it a 6.5, Sluss writes, "The good news is that, on average, this was the best season of Voyager. The bad news is that, on average, this was the best season of Voyager." The review consists of three parts, namely a look at the season as a whole, then 'autopsies' of all the individual episodes, and finally the Third Annual Cy Awards, with awards in categories such as 'Court-Martial Offense of the Year', 'Welfare Recipient of the Year', and of course the best and worst actors/actresses/episodes. Here's part of the introduction to the general season review: This season is a lot like the last two. There are a couple of near-gems, loads of mediocre episodes, and several dogs. The near-gem-to-dog ratio was a little bit higher this year, but not enough to make Voyager a truly respectable series. Voyager still hasn't overcome or even attempted to address the many problems that have plagued the series since practically the beginning. I think we all know what they are, though some are unwilling to acknowledge them, but here's a partial list: Lack of consequences, lack of continuity, lack of consistent characterization, excessive use of contrivances and/or technobabble McGuffins, excessive use of cynical stunt casting, reset button and/or five-minutes-to-the-end endings, ridiculous science, and cliches. This show has always lacked focus, consistency and an adherence to the basic premise of the series, and this year was no exception. Sluss also mentions at the site there'll be some more Cynics Corner articles to look forward to over the summer, and next year there will likely even be 'Andromeda' reviews. You can find the Cynics Corner by going here.

Monday, August 28, 2006 Wait wait wait! I'm still trying to catch up to the Continental email from a few days ago. Luckily, the picture I was thinking I would post is actually in the same vein as your baby post today. Check it out - Manitoba, subject of the Page Six link from the other day, and his son, Minitoba (aka Jake, a fighter's name, of course). So, the Continental is going under? Well, in the 90s that was definitely the East Village bar that, in my opinion, had the bleakest aura. It was a bit better when Todd Youth was there, bartending or keeping an eye on the door, wearing his white creepers and seeming like he was the kind of guy who would keep an eye out for you, which he did for me one night when the frat guys got a little too close for his comfort. But generally, it was a railroad flat of a bar, dark and grimy, and the kind of place you would only go right when the band was going on, never before, never just to drink. Unless you were broke and someone was slipping you freebies. I used to go in to the Continental to bring the bar manager cat food. He was Pauly's roommate, and a mess of a guy, barely coherent most of the time, even though somehow people knew he was smart, or used to be. He kept a kitten at the apartment for a while, and it was pitifully small, so I would bring these cans of cat food for him, since I didn't trust this guy to feed the cat. Then one day the cat was gone. I never knew what happened to it. Pauly refused to pet the cat, or like it because he said "It's just going to be gone soon anyway." And he was right. The best thing that I can say about that particular bar manager is that he led to one of my favorite NY stories - the time I walked through Pauly's living room at 2AM and much to my surprise found Joey Ramone parked on the couch. But your post, and the link to Page Six, and some other recent events in my life, have left me thinking about Richard, who I hope will not sue me for posting this. If anyone was going to sue me for posting about them, it would probably be Richard, since if we were having a "Heather's Most Famous Ex-Boyfriend" contest, he would win, hands-down. Dictators? Manitoba's? And I guess recently, sometimes, MC5. In 2004, when the lead singer for Guided By Voices asked the crowd at Bowery Ballroom who the last good NYC Mayor was, the answer he liked was "Handsome Dick Manitoba!" But Richard didn't start out famous to me, even though he'd been famous to the East Village for decades. When I met him, he was one of the downstairs bartenders at 2A. Richard was the guy who made Whiskey Sours from scratch, such good, good Whiskey Sours. So, it's ironic that I've always sort-of thought of him as the guy who saved me from the Betty. Richard came along at a time when I was spending too much time on bar stools, drinking too much whiskey, and failing to toughen up even though I was frequenting some places that really called for that. I think hanging out with all the tough guys only made me more tender by contrast. Before Richard, I loved Pauly, who had reached a point in his life where he thought it made sense to be the kind of guy who smoked even in the shower. Then there was Darren, who said "I never argue. I never argue, because I'll only argue when I'm right, and if I'm right, the argument's over" and meant it. So Richard, it turned out, was a relief. He was a bartender, but a sober bartender, and in general, irrepressibly good humored, even when he had every reason not to be. He was kind and paid attention, and loved good food and wrestling. Pro-wrestling, people. And he was the only person who I EVER saw have the pull with Rizzo to get in to Green Door free (and he was plus at least two, since I know you were with us, Ali). Some things I remember:- Most of the time when he saw me come in to the bar, he would say "Heather WEIN-traub!", a reference to Mean Streets. He loved Scorcese.- One night we were going out, and I wore something a little more bare than was my habit, and he looked at me and said "Are you trying to get me into a fight?"- Eating at the old Odessa, where he knew all the waitresses, before they renovated it and made it so damn bright you could have done surgery in there- He used to work the door at Niagara (which was called something else in those days) and I thought he looked cute all bundled up in his leather jacket with a hoody AND a hat. So, even though he wasn't famous to me, I loved Richard, and I still feel some gratitude to him for showing me that the East Village could be a different kind of place. One where a sober bartender could also be a punk-rock, bar-owning, east-village-ruling celebrity, the kind who cares about being loyal to his friends and is good to his girl. But the guy I loved was always much more Richard than Handsome Dick Manitoba. In spite of that, I would be lying if I didn't admit that it was fun when Jason (who still holds the title of the man with the most astounding record collection I have ever seen) said to me "You realize you are dating a punk-rock legend, don't you?" I didn't really at the time, but it sure seems a whole lot more clear now. To me he was a good guy who helped make it clear to me that maybe it was time for me to change what I had been thinking of as my New York Ways. And I did. Hey, Ali, how could you forget The Ex-Husbands? But that's a whole other story...

Redesigning space for interdisciplinary connections: the Puget Sound Science Center. Mindful design of learning spaces can provide an avenue for supporting student engagement in STEM subjects. Thoughtful planning and wide participation in the design process were key in shaping new and renovated spaces for the STEM community at the University of Puget Sound. The finished project incorporated Puget Sound's mission and goals as well as attention to pedagogical principles, and led to connections and integration throughout the learning environment, specifically at the biochemistry and molecular life sciences intersections.

Q: Hibernate : Criteria ignoring fetchSize parameter and fetching more rows than asked I am working on a Spring-MVC application in which I have a search function written using Criteria. FOr paginated search, I get from front-end the firstResult and fetchSize as the parameter. Unfortunately, Criteria is ignoring them and returning a huge list(around 1000 rows) when asked only for 20 rows. What is going wrong? Code : System.out.println("Fetch size is "+fetchSize); System.out.println("First result is "+firstResult); Criteria andCriteria = session.createCriteria(Host.class); Conjunction and = Restrictions.conjunction(); if((studentSearchHistory.getCity()!=null) && (!(studentSearchHistory.getCity().isEmpty()))) { and.add(Restrictions.ilike("city", studentSearchHistory.getCity())); } //Other search conditions andCriteria.setFetchSize(fetchSize); andCriteria.setFirstResult(firstResult); andCriteria.add(and); hostList.addAll(andCriteria.list()); if(hostList != null){ System.out.println("Host list size is "+hostList.size()); } Output : Fetch size is 10 First result is 0 Host list size is 1003 What am I doing wrong? THank you. A: Maybe you should using setMaxResults here. Here is a comparation for these two methods.

Induction and repair of DNA base damage studied in X-irradiated CHO cells using the M. luteus extract. DNA base damage was measured in Chinese hamster ovary cells X-irradiated under aerobic conditions using an extract of the bacterium Micrococcus luteus. The glycosylases and endonucleases present in this extract recognize damaged bases and convert them into strand breaks (termed endonuclease-sensitive sites, enss). Strand breaks were detected by the alkaline unwinding technique. The induction of enss was measured for X-ray doses ranging up to 45 Gy. The relative frequency of all enss related to all radiation induced strand breaks was 1.7 +/- 0.4. Repair of enss was studied for a radiation dose of 45 Gy. The number of enss was found to decrease exponentially with time after irradiation with a half-time of tau enss = 37 +/- 8 min. The repair kinetics that were also measured for all X-ray-induced DNA strand breaks were found to consist of three phases: fast, intermediate and slow. The intermediate phase was fitted under the assumption that this phase results from the formation and repair of secondary single-strand breaks generated by enzymatic incision at the sites of base damage repair. The relative frequency of base damage derived from this fit was 1.8 +/- 0.5 and the half-time of base damage repair was tau in = 32 +/- 6 min. The agreement of this half-time with the half-time obtained when base damage was measured directly using the M. luteus assay gives support to the interpretation that the intermediate phase of the total repair curve represents the kinetics of secondary strand breaks resulting from base damage by enzymatic incision.

import flat from "array.prototype.flat"; import { fromEntries } from "./object-entries"; type LineIndex = number; type ColumnIndex = number; export function parseFocus(focus: string) { if (!focus) { throw new Error("Focus cannot be empty"); } try { const parts = focus.split(/,(?![^\[]*\])/g).map(parsePart); return fromEntries(flat(parts)); } catch (error) { // TODO enhance error throw error; } } type Part = [LineIndex, true | ColumnIndex[]]; function parsePart(part: string): Part[] { // a part could be // - a line number: "2" // - a line range: "5:9" // - a line number with a column selector: "2[1,3:5,9]" const columnsMatch = part.match(/(\d+)\[(.+)\]/); if (columnsMatch) { const [, line, columns] = columnsMatch; const columnsList = columns.split(",").map(expandString); const lineIndex = Number(line) - 1; const columnIndexes = flat(columnsList).map(c => c - 1); return [[lineIndex, columnIndexes]]; } else { return expandString(part).map(lineNumber => [lineNumber - 1, true]); } } function expandString(part: string) { // Transforms something like // - "1:3" to [1,2,3] // - "4" to [4] const [start, end] = part.split(":"); if (!isNaturalNumber(start)) { throw new FocusNumberError(start); } const startNumber = Number(start); if (startNumber < 1) { throw new LineOrColumnNumberError(); } if (!end) { return [startNumber]; } else { if (!isNaturalNumber(end)) { throw new FocusNumberError(end); } const list: number[] = []; for (let i = startNumber; i <= +end; i++) { list.push(i); } return list; } } function isNaturalNumber(n: any) { n = n.toString(); // force the value in case it is not var n1 = Math.abs(n), n2 = parseInt(n, 10); return !isNaN(n1) && n2 === n1 && n1.toString() === n; } export function getFocusSize(focus: Record<LineIndex, true | ColumnIndex[]>) { const lineIndexList = Object.keys(focus).map(k => +k); const focusStart = Math.min.apply(Math, lineIndexList); const focusEnd = Math.max.apply(Math, lineIndexList); return { focusCenter: (focusStart + focusEnd + 1) / 2, focusCount: focusEnd - focusStart + 1 }; } export class LineOrColumnNumberError extends Error { constructor() { super(`Invalid line or column number in focus string`); Object.setPrototypeOf(this, new.target.prototype); } } export class FocusNumberError extends Error { number: string; constructor(number: string) { super(`Invalid number "${number}" in focus string`); this.number = number; Object.setPrototypeOf(this, new.target.prototype); } }

Saturday, July 10, 2010 Monday - I enjoyed spending time with my family. Fun times cooking out and enjoying the pool! Tuesday- It seemed like Monday all day but fun times planning the Fall with the Childhood Ministries staff. Tuesday night the baby I have asked you to pray for, Joshua, was born. Wednesday- Baby Joshua died after 12 hours. Thanking Jesus for the gift of children and his grace to allow his momma to hold him. Wednesday night we have the Team Family Scavenger Hunt = Team Scannapiego wins! Thursday- A busy day with new church stuff........I head to my parent's house to celebrate my youngest cousins 1st Birthday! (Yes, I will be 40 this month and he turned 1- LOL). Friday- Lunch with a friend for more Fall Planning. Head to my mamaw's house to help her with her computer. Then I think I am headed to swim BUT the much needed rain comes and cancels those plans. I head to eat at my favorite lakeside restaurant - Dockside (in Harrison Bay State Park). Head to new church and WOW! Saturday - doing nothing but watching all the MATLOCK shows I have on DVR. Yes, I love Matlock. Hope you are having a great weekend! Please continue to pray for a miracle for Baby Hadley. I also ask you to pray for my friend Sheron's sister/hubby as their whole family grieves the loss of Joshua. Friday, July 2, 2010 Yesterday was a fun day- although busy. I got to visit a family in our church who just had twins- Ariel and Aiden. The family has 6 boys already so with the new babies they have 8 children. What a fun time I had getting to hold these precious wonders. I also enjoyed getting to see how much the boys had grown - especially Micah and Ethan. Ethan made me laugh because he giggled a WHOLE lot. Then I went to an Adoption Celebration for another family in our church- Jake and Merica. I have the privilege of serving on staff with Jake. The celebration was for their new son who will hopefully get an approved visa soon so they can go get him in India. At the celebration I got to play/see with lots of little friends -Cade, Mary Evelyn, Lia, Harper, Dosen, Matthew, Andrew, Morgan and I got to see some older siblings (see because they were playing older kids games) Luke, Dosen, Fletcher, Winston, Emmy, Anna Grace,.............. hope I didn't leave anyone out. It was a sweet time of fellowship, fun and prayers over a family who hope to bring their son home soon. Please pray all comes together soon. There was also a family there who was to leave today to go and get their child from Ethiopia. I was very excited I got to hear my friend Cade talk for the very first time. He is normally very quiet around me. It was so sweet. Also I was so proud of my friend Mary Evelyn for sharing her toys. She was such a big girl. I had let some of the little kids put my keys in her lunchbox. Matter of fact I gave them to and said put them in the lunchbox. Well as Mary Evelyn said goodbye I luckily remembered my keys! I could have been stuck- OH NO! I also got to see a family in our church who is expecting very soon! Today I have been praying for two families- Jared & Jane and Ryan & Crystal- who need a miracle for their unborn babies. Jared and Jane's baby girl Hadley has been diagnosed with thanatophoricdysplasia. Jane is due in early November. Ryan and Crysal's baby boy Joshua Matthew has been diagnosed with a bone dysplasia. Crystal is due in early August. Both have been told this is fatal to their babies. Both couples were encouraged to abort their babies. These couples decided to carry their babies and trust God with their precious children! Will you join me in praying for them? Jared and Jane have a group on Facebook you can join (and leave them encouraging words) - Search for the group Praying for Hadley. Jane is my Co-Pastor- Jim's daugther. Crystal is the sister of one of my volunteers at church Sheron. I am praying for a miracle for Hadley and Joshua. I am thankful for children. I have been deeply impacted to pray for all the unborn children. I have been reminded to pray for those awaiting forever families both here and around the world. I have been praying for all children as they continue to learn and grow. I love children. I am also thankful for a Heavenly Father who loves them MORE! About Me I am blessed to be a daughter of the Most High King, a wife to the most precious and godly man I know, a daughter to super duper fun parents who gave me an incredible spiritual heritage and two sisters I love more than life itself. The Lord has allowed me to minister to children and their families for 23 years and counting! Passionate about Jesus, Family, Missions, YL Essential Oils and Disney

Q: C++: Filescope constants with same name are breaking one definition rule? I have 2 constants in 2 different .cpp files, both named const char const * TEXTURE_FILENAME = "..."; One is in a.cpp and the other is in b.cpp, at the file scope, and neither file includes the other or should see one another, but VS2010 generates this linker error: a.obj : error LNK2005: "char const * const TEXTURE_FILENAME" (?TEXTURE_FILENAME@@3PBDB) already defined in b.obj What am I doing wrong here, and how might I fix it without needing to rename either constant? A: What am I doing wrong here, and how might I fix it without needing to rename either constant? You are defining two objects named TEXTURE_FILENAME. That's the problem. There are more than one ways to fix the problem. The simplest fix is to make them static in file scope. static const char * TEXTURE_FILENAME = "..."; Update, in response to OP's comment TEXTURE_FILENAME is not a const object. It happens to point to a C style string that is const. You can modify where TEXTURE_FILENAME elsewhere in the file by using: TEXTURE_FILENAME = <some other C style string>; To make TEXTURE_FILENAME a const, you'll need to use: // Both the pointer and what it points to are const. const char * const TEXTURE_FILENAME = "...";

using UnityEngine; using System.Collections; public class Shell : MonoBehaviour { public Rigidbody myRigidbody; public float forceMin; public float forceMax; float lifetime = 4; float fadetime = 2; void Start () { float force = Random.Range (forceMin, forceMax); myRigidbody.AddForce (transform.right * force); myRigidbody.AddTorque (Random.insideUnitSphere * force); StartCoroutine (Fade ()); } IEnumerator Fade() { yield return new WaitForSeconds(lifetime); float percent = 0; float fadeSpeed = 1 / fadetime; Material mat = GetComponent<Renderer> ().material; Color initialColour = mat.color; while (percent < 1) { percent += Time.deltaTime * fadeSpeed; mat.color = Color.Lerp(initialColour, Color.clear, percent); yield return null; } Destroy (gameObject); } }

SKOWHEGAN — A $400,000 state block grant has been approved to continue a revitalization program intended to help position downtown as a destination for cultural and food-related activities. The money will fund the second and final phase of a makeover of the municipal parking lot downtown, a key element in improving the appearance of the central business district. Additional Photos PROGRESS: Workers install granite sidewalk sections and prepare to resurface the parking lot Thursday near the Somerset Grist Mill in Skowhegan as part of a $400,000 grant paying for upgrading the municipal parking lot. Staff photo by David Leaming Jeffrey Hewitt, the town’s economic and community development director, said a safe, attractive downtown parking lot with trees, benches and sidewalk islands will help make Skowhegan a destination for visitors and shoppers. Hewett said the project is especially important to attractions near the parking area, such as the proposed Run of River white water park in the Kennebec River Gorge, which runs through downtown, as well as the Skowhegan Farmers’ Market and businesses inside the Somerset Grist Mill. “Between this project, the grist mill and other improvements we have done downtown and the walking trail across the river and the Run of River, it’s starting to get you some mass that people are saying, ‘Gee, maybe we should start thinking about opening up something here,'” he said “It’s helping develop the downtown as a good place to come and visit. Every project is one step closer.” Grist Mill owner Amber Lambke said the overall project will be a boon to downtown Skowhegan. “I thinks it makes the entire downtown more attractive and significantly safer for pedestrians and projects a welcoming community,” Lambke said. “Visitors are going to want to see our local markets (and) our businesses. We have one of the most vibrant food scenes in the state.” The work includes pedestrian walkways, light poles, trees, benches, granite curbs and directional signs. The new municipal parking lot will feature raised landscaping, including about 20 flowering trees and 15 hardwood trees, with several varieties of maple. Construction on Phase One of the project got underway May 1 in the lot next the Grist Mill, High Street and an auto dealership. Phase Two of the parking lot project is expected to begin in mid-July when all of the Phase One work is completed. It will include removing and replacing existing stormwater catch basins and underground piping. The existing pavement will be ground up and hauled away to be reclaimed for future use. The land then will be graded, paved and stripped for parking. Hewett said he expects the new paving to be done quickly over three days and nights of work. The work this summer means the new-look parking area will be ready before construction of the ambitious Run of River attraction begins next year. The $4.3 million project will create whitewater waves in three locations to attract boaters for a park-and-play destination, waves for surfers and body boarders, and a half-mile run for rafting and kayaking. Work on the project is projected to start in October 2015. Total funding received for the revitalization project comes to about $950,000, including $400,000 in state bond money for Phase One. The town will provide a matching contribution of $100,000 for the project. Skowhegan’s share comes from the downtown tax increment financing, or TIF, district. Hewett said it is worth the expense. “I can think of three different reasons this project is important,” he said. “One, it makes the downtown parking lot pedestrian friendly, safe for people and parking. It makes it an attractive place, something that people like the looks of; and it allows us to do a project that normally would have been done straight through taxation, and we’ve picked it up through these grants.” Here at MaineToday Media we value our readers and are committed to growing our community by encouraging you to add to the discussion. To ensure conscientious dialogue we have implemented a strict no-bullying policy. To participate, you must follow our Terms of Use. Click here to flag and report a comment that violates our terms of use.

# -*- coding: utf-8 -*- """Specific data provider for Russia (ru).""" from mimesis.builtins.base import BaseSpecProvider from mimesis.enums import Gender from mimesis.typing import Seed __all__ = ['RussiaSpecProvider'] class RussiaSpecProvider(BaseSpecProvider): """Class that provides special data for Russia (ru).""" def __init__(self, seed: Seed = None): """Initialize attributes.""" super().__init__(locale='ru', seed=seed) self._pull(self._datafile) class Meta: """The name of the provider.""" name = 'russia_provider' def generate_sentence(self) -> str: """Generate sentence from the parts. :return: Sentence. """ sentences = self._data['sentence'] sentence = [ self.random.choice(sentences[k]) for k in ('head', 'p1', 'p2', 'tail') ] return '{0} {1} {2} {3}'.format(*sentence) def patronymic(self, gender: Gender = None) -> str: """Generate random patronymic name. :param gender: Gender of person. :return: Patronymic name. :Example: Алексеевна. """ gender = self._validate_enum(gender, Gender) patronymics = self._data['patronymic'][gender] return self.random.choice(patronymics) def passport_series(self, year: int = None) -> str: """Generate random series of passport. :param year: Year of manufacture. :type year: int or None :return: Series. :Example: 02 15. """ if not year: year = self.random.randint(10, 18) region = self.random.randint(1, 99) return '{:02d} {}'.format(region, year) def passport_number(self) -> int: """Generate random passport number. :return: Number. :Example: 560430 """ return self.random.randint( 100000, 999999) def series_and_number(self) -> str: """Generate a random passport number and series. :return: Series and number. :Example: 57 16 805199. """ return '{}{}'.format( self.passport_series(), self.passport_number(), ) def snils(self) -> str: """Generate snils with special algorithm. :return: SNILS. :Example: 41917492600. """ numbers = [] control_codes = [] for i in range(0, 9): numbers.append(self.random.randint(0, 9)) for i in range(9, 0, -1): control_codes.append(numbers[9 - i] * i) control_code = sum(control_codes) code = ''.join(str(number) for number in numbers) if control_code in (100, 101): snils = code + '00' return snils if control_code < 100: snils = code + str(control_code) return snils if control_code > 101: control_code = control_code % 101 if control_code == 100: control_code = 0 snils = code + '{:02}'.format(control_code) return snils def inn(self) -> str: """Generate random, but valid ``INN``. :return: INN. """ def control_sum(nums: list, t: str) -> int: digits_dict = { 'n2': [7, 2, 4, 10, 3, 5, 9, 4, 6, 8], 'n1': [3, 7, 2, 4, 10, 3, 5, 9, 4, 6, 8], } number = 0 digits = digits_dict[t] for i in range(0, len(digits)): number += nums[i] * digits[i] return number % 11 % 10 numbers = [] for x in range(0, 10): numbers.append(self.random.randint(1 if x == 0 else 0, 9)) n2 = control_sum(numbers, 'n2') numbers.append(n2) n1 = control_sum(numbers, 'n1') numbers.append(n1) return ''.join([str(x) for x in numbers]) def ogrn(self) -> str: """Generate random valid ``OGRN``. :return: OGRN. :Example: 4715113303725. """ numbers = [] for _ in range(0, 12): numbers.append(self.random.randint(1 if _ == 0 else 0, 9)) ogrn = ''.join([str(x) for x in numbers]) check_sum = str(int(ogrn) % 11 % 10) return '{}{}'.format(ogrn, check_sum) def bic(self) -> str: """Generate random ``BIC`` (Bank ID Code). :return: BIC. :Example: 044025575. """ country_code = '04' code = '{:02}'.format(self.random.randint(1, 10)) bank_number = '{:02}'.format(self.random.randint(0, 99)) bank_office = '{:03}'.format(self.random.randint(50, 999)) bic = country_code + code + bank_number + bank_office return bic def kpp(self) -> str: """Generate random ``KPP``. :return: 'KPP'. :Example: 560058652. """ tax_codes = [ '7700', '7800', '5000', '0100', '0200', '0300', '0500', '0600', '0700', '0800', '0900', '1000', '1100', '1200', '1300', '1400', '1500', '1600', '1700', '1800', '1900', '2000', '2100', '2200', '2300', '2400', '2500', '2600', '2700', '2800', '2900', '3000', '3100', '3200', '3300', '3400', '3500', '3600', '3700', '3800', '3900', '4000', '4100', '4900', '5100', '5200', '5300', '5400', '5500', '5600', '5700', '5800', '5900', '6000', '6100', '6200', '6300', '6400', '6500', '6600', '6700', '6800', '6900', '7000', '7100', '7200', '7300', '7400', '7500', '7600', '7900', '8600', '8700', '8900', '9100', '9200', '9800', '9900', '9901', '9951', '9952', '9953', '9954', '9955', '9956', '9957', '9958', '9959', '9961', '9962', '9965', '9966', '9971', '9972', '9973', '9974', '9975', '9976', '9977', '9979', '9998', ] tax_code = tax_codes[self.random.randint(0, len(tax_codes) - 1)] reg_code = '{:02}'.format(self.random.randint(1, 99)) reg_number = '{:03}'.format(self.random.randint(1, 999)) kpp = tax_code + reg_code + reg_number return kpp

Guazu-Cua Guazú Cuá (Guaraní: Guasu Kua) is a village and distrito in Paraguay, located 14 kilometres south of Escobar. Guazú Cuá is a small rural community of around 440 people. Guazú Cuá has a school that goes up to the 11th grade, a well run healthpost, a police station, a church, soccer field with lights for night-time games and its own bus line, Linea 10 GuasuKua. Sources World Gazeteer: Paraguay – World-Gazetteer.com Category:Populated places in the Ñeembucú Department

[Obtaining and morphological characteristics of primary monolayer cell cultures of human somatotropinomas]. This paper describes the development of method of preparing cell suspension obtained from surgical material of patients with pituitary adenomas and acromegaly as well as the procedure of subsequent long-term cultivation in monolayers of the cells isolated. As judged by visual inspection and measurement of growth hormone and prolactin secretion, tumor pituitary cells kept viability and functional activity for at least 6 days of growing in vitro. Immunocytochemical visualization of somato- and lactotrophs of the same histological preparations permitted us to show that vast majority of cultured cells is represented by somatotrophs; however, a small portion of cell population is represented by lactotrophs and lactosomatotrophs. The peculiarities of cytoarchitectonics in two types of cell cultures of human somatotropinomas were studied.

# -*- coding: utf-8 -*- # # Copyright (C) 2015 GNS3 Technologies Inc. # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. """ VMware player/workstation server module. """ import os import sys import re import shutil import asyncio import subprocess import logging import codecs from collections import OrderedDict from gns3server.utils.interfaces import interfaces from gns3server.utils.asyncio import subprocess_check_output from gns3server.utils import parse_version, shlex_quote log = logging.getLogger(__name__) from gns3server.compute.base_manager import BaseManager from gns3server.compute.vmware.vmware_vm import VMwareVM from gns3server.compute.vmware.vmware_error import VMwareError class VMware(BaseManager): _NODE_CLASS = VMwareVM def __init__(self): super().__init__() self._vmware_inventory_lock = asyncio.Lock() self._vmrun_path = None self._host_type = None self._vmnets = [] self._vmnet_start_range = 2 if sys.platform.startswith("win"): self._vmnet_end_range = 19 else: self._vmnet_end_range = 255 @property def vmrun_path(self): """ Returns the path vmrun utility. :returns: path """ return self._vmrun_path @staticmethod def _find_vmrun_registry(regkey): import winreg try: # default path not used, let's look in the registry hkey = winreg.OpenKey(winreg.HKEY_LOCAL_MACHINE, regkey) install_path, _ = winreg.QueryValueEx(hkey, "InstallPath") vmrun_path = os.path.join(install_path, "vmrun.exe") winreg.CloseKey(hkey) if os.path.exists(vmrun_path): return vmrun_path except OSError: pass return None def find_vmrun(self): """ Searches for vmrun. :returns: path to vmrun """ # look for vmrun vmrun_path = self.config.get_section_config("VMware").get("vmrun_path") if not vmrun_path: if sys.platform.startswith("win"): vmrun_path = shutil.which("vmrun") if vmrun_path is None: # look for vmrun.exe using the VMware Workstation directory listed in the registry vmrun_path = self._find_vmrun_registry(r"SOFTWARE\Wow6432Node\VMware, Inc.\VMware Workstation") if vmrun_path is None: # look for vmrun.exe using the VIX directory listed in the registry vmrun_path = self._find_vmrun_registry(r"SOFTWARE\Wow6432Node\VMware, Inc.\VMware VIX") elif sys.platform.startswith("darwin"): vmrun_path = "/Applications/VMware Fusion.app/Contents/Library/vmrun" else: vmrun_path = "vmrun" if vmrun_path and not os.path.isabs(vmrun_path): vmrun_path = shutil.which(vmrun_path) if not vmrun_path: raise VMwareError("Could not find VMware vmrun, please make sure it is installed") if not os.path.isfile(vmrun_path): raise VMwareError("vmrun {} is not accessible".format(vmrun_path)) if not os.access(vmrun_path, os.X_OK): raise VMwareError("vmrun is not executable") if os.path.basename(vmrun_path).lower() not in ["vmrun", "vmrun.exe"]: raise VMwareError("Invalid vmrun executable name {}".format(os.path.basename(vmrun_path))) self._vmrun_path = vmrun_path return vmrun_path @staticmethod def _find_vmware_version_registry(regkey): import winreg version = None try: # default path not used, let's look in the registry hkey = winreg.OpenKey(winreg.HKEY_LOCAL_MACHINE, regkey) version, _ = winreg.QueryValueEx(hkey, "ProductVersion") winreg.CloseKey(hkey) except OSError: pass if version is not None: match = re.search(r"([0-9]+)\.", version) if match: version = match.group(1) return version async def _check_vmware_player_requirements(self, player_version): """ Check minimum requirements to use VMware Player. VIX 1.13 was the release for Player 6. VIX 1.14 was the release for Player 7. VIX 1.15 was the release for Workstation Player 12. VIX 1.17 was the release for Workstation Player 14. :param player_version: VMware Player major version. """ player_version = int(player_version) if player_version < 6: raise VMwareError("Using VMware Player requires version 6 or above") elif player_version == 6: await self.check_vmrun_version(minimum_required_version="1.13.0") elif player_version == 7: await self.check_vmrun_version(minimum_required_version="1.14.0") elif player_version >= 12: await self.check_vmrun_version(minimum_required_version="1.15.0") elif player_version >= 14: await self.check_vmrun_version(minimum_required_version="1.17.0") self._host_type = "player" async def _check_vmware_workstation_requirements(self, ws_version): """ Check minimum requirements to use VMware Workstation. VIX 1.13 was the release for Workstation 10. VIX 1.14 was the release for Workstation 11. VIX 1.15 was the release for Workstation Pro 12. VIX 1.17 was the release for Workstation Pro 14. :param ws_version: VMware Workstation major version. """ ws_version = int(ws_version) if ws_version < 10: raise VMwareError("Using VMware Workstation requires version 10 or above") elif ws_version == 10: await self.check_vmrun_version(minimum_required_version="1.13.0") elif ws_version == 11: await self.check_vmrun_version(minimum_required_version="1.14.0") elif ws_version >= 12: await self.check_vmrun_version(minimum_required_version="1.15.0") elif ws_version >= 14: await self.check_vmrun_version(minimum_required_version="1.17.0") self._host_type = "ws" async def check_vmware_version(self): """ Check VMware version """ if sys.platform.startswith("win"): # look for vmrun.exe using the directory listed in the registry ws_version = self._find_vmware_version_registry(r"SOFTWARE\Wow6432Node\VMware, Inc.\VMware Workstation") if ws_version is None: player_version = self._find_vmware_version_registry(r"SOFTWARE\Wow6432Node\VMware, Inc.\VMware Player") if player_version: log.debug("VMware Player version {} detected".format(player_version)) await self._check_vmware_player_requirements(player_version) else: log.warning("Could not find VMware version") self._host_type = "ws" else: log.debug("VMware Workstation version {} detected".format(ws_version)) await self._check_vmware_workstation_requirements(ws_version) else: if sys.platform.startswith("darwin"): if not os.path.isdir("/Applications/VMware Fusion.app"): raise VMwareError("VMware Fusion is not installed in the standard location /Applications/VMware Fusion.app") self._host_type = "fusion" return # FIXME: no version checking on Mac OS X but we support all versions of fusion vmware_path = VMware._get_linux_vmware_binary() if vmware_path is None: raise VMwareError("VMware is not installed (vmware or vmplayer executable could not be found in $PATH)") try: output = await subprocess_check_output(vmware_path, "-v") match = re.search(r"VMware Workstation ([0-9]+)\.", output) version = None if match: # VMware Workstation has been detected version = match.group(1) log.debug("VMware Workstation version {} detected".format(version)) await self._check_vmware_workstation_requirements(version) match = re.search(r"VMware Player ([0-9]+)\.", output) if match: # VMware Player has been detected version = match.group(1) log.debug("VMware Player version {} detected".format(version)) await self._check_vmware_player_requirements(version) if version is None: log.warning("Could not find VMware version. Output of VMware: {}".format(output)) raise VMwareError("Could not find VMware version. Output of VMware: {}".format(output)) except (OSError, subprocess.SubprocessError) as e: log.error("Error while looking for the VMware version: {}".format(e)) raise VMwareError("Error while looking for the VMware version: {}".format(e)) @staticmethod def _get_vmnet_interfaces_registry(): import winreg vmnet_interfaces = [] regkey = r"SOFTWARE\Wow6432Node\VMware, Inc.\VMnetLib\VMnetConfig" try: hkey = winreg.OpenKey(winreg.HKEY_LOCAL_MACHINE, regkey) for index in range(winreg.QueryInfoKey(hkey)[0]): vmnet = winreg.EnumKey(hkey, index) hkeyvmnet = winreg.OpenKey(hkey, vmnet) if winreg.QueryInfoKey(hkeyvmnet)[1]: # the vmnet has not been configure if the key has no values vmnet = vmnet.replace("vm", "VM") if vmnet not in ("VMnet0", "VMnet1", "VMnet8"): vmnet_interfaces.append(vmnet) winreg.CloseKey(hkeyvmnet) winreg.CloseKey(hkey) except OSError as e: raise VMwareError("Could not read registry key {}: {}".format(regkey, e)) return vmnet_interfaces @staticmethod def _get_vmnet_interfaces(): if sys.platform.startswith("win"): return VMware._get_vmnet_interfaces_registry() elif sys.platform.startswith("darwin"): vmware_networking_file = "/Library/Preferences/VMware Fusion/networking" else: # location on Linux vmware_networking_file = "/etc/vmware/networking" vmnet_interfaces = [] try: with open(vmware_networking_file, "r", encoding="utf-8") as f: for line in f.read().splitlines(): match = re.search(r"VNET_([0-9]+)_VIRTUAL_ADAPTER", line) if match: vmnet = "vmnet{}".format(match.group(1)) if vmnet not in ("vmnet0", "vmnet1", "vmnet8"): vmnet_interfaces.append(vmnet) except OSError as e: raise VMwareError("Cannot open {}: {}".format(vmware_networking_file, e)) return vmnet_interfaces @staticmethod def _get_vmnet_interfaces_ubridge(): vmnet_interfaces = [] for interface in interfaces(): if sys.platform.startswith("win"): if "netcard" in interface: windows_name = interface["netcard"] else: windows_name = interface["name"] match = re.search(r"(VMnet[0-9]+)", windows_name) if match: vmnet = match.group(1) if vmnet not in ("VMnet0", "VMnet1", "VMnet8"): vmnet_interfaces.append(vmnet) elif interface["name"].startswith("vmnet"): vmnet = interface["name"] if vmnet not in ("vmnet0", "vmnet1", "vmnet8"): vmnet_interfaces.append(interface["name"]) return vmnet_interfaces def is_managed_vmnet(self, vmnet): self._vmnet_start_range = self.config.get_section_config("VMware").getint("vmnet_start_range", self._vmnet_start_range) self._vmnet_end_range = self.config.get_section_config("VMware").getint("vmnet_end_range", self._vmnet_end_range) match = re.search(r"vmnet([0-9]+)$", vmnet, re.IGNORECASE) if match: vmnet_number = match.group(1) if self._vmnet_start_range <= int(vmnet_number) <= self._vmnet_end_range: return True return False def allocate_vmnet(self): if not self._vmnets: raise VMwareError("No VMnet interface available between vmnet{} and vmnet{}. Go to preferences VMware / Network / Configure to add more interfaces.".format(self._vmnet_start_range, self._vmnet_end_range)) return self._vmnets.pop(0) def refresh_vmnet_list(self, ubridge=True): if ubridge: # VMnet host adapters must be present when uBridge is used vmnet_interfaces = self._get_vmnet_interfaces_ubridge() else: vmnet_interfaces = self._get_vmnet_interfaces() # remove vmnets already in use for vmware_vm in self._nodes.values(): for used_vmnet in vmware_vm.vmnets: if used_vmnet in vmnet_interfaces: log.debug("{} is already in use".format(used_vmnet)) vmnet_interfaces.remove(used_vmnet) # remove vmnets that are not managed for vmnet in vmnet_interfaces.copy(): if vmnet in vmnet_interfaces and self.is_managed_vmnet(vmnet) is False: vmnet_interfaces.remove(vmnet) self._vmnets = vmnet_interfaces @property def host_type(self): """ Returns the VMware host type. player = VMware player ws = VMware Workstation fusion = VMware Fusion :returns: host type (string) """ return self._host_type async def execute(self, subcommand, args, timeout=120, log_level=logging.INFO): trial = 2 while True: try: return (await self._execute(subcommand, args, timeout=timeout, log_level=log_level)) except VMwareError as e: # We can fail to detect that it's VMware player instead of Workstation (due to marketing change Player is now Player Workstation) if self.host_type == "ws" and "VIX_SERVICEPROVIDER_VMWARE_WORKSTATION" in str(e): self._host_type = "player" return (await self._execute(subcommand, args, timeout=timeout, log_level=log_level)) else: if trial <= 0: raise e trial -= 1 await asyncio.sleep(0.5) async def _execute(self, subcommand, args, timeout=120, log_level=logging.INFO): if self.host_type is None: await self.check_vmware_version() vmrun_path = self.vmrun_path if not vmrun_path: vmrun_path = self.find_vmrun() command = [vmrun_path, "-T", self.host_type, subcommand] command.extend(args) command_string = " ".join([shlex_quote(c) for c in command]) log.log(log_level, "Executing vmrun with command: {}".format(command_string)) try: process = await asyncio.create_subprocess_exec(*command, stdout=asyncio.subprocess.PIPE, stderr=asyncio.subprocess.PIPE) except (OSError, subprocess.SubprocessError) as e: raise VMwareError("Could not execute vmrun: {}".format(e)) try: stdout_data, _ = await asyncio.wait_for(process.communicate(), timeout=timeout) except asyncio.TimeoutError: raise VMwareError("vmrun has timed out after {} seconds!\nTry to run {} in a terminal to see more details.\n\nMake sure GNS3 and VMware run under the same user and whitelist vmrun.exe in your antivirus.".format(timeout, command_string)) if process.returncode: # vmrun print errors on stdout vmrun_error = stdout_data.decode("utf-8", errors="ignore") raise VMwareError("vmrun has returned an error: {}\nTry to run {} in a terminal to see more details.\nAnd make sure GNS3 and VMware run under the same user.".format(vmrun_error, command_string)) return stdout_data.decode("utf-8", errors="ignore").splitlines() async def check_vmrun_version(self, minimum_required_version="1.13.0"): """ Checks the vmrun version. VMware VIX library version must be at least >= 1.13 by default VIX 1.13 was the release for VMware Fusion 6, Workstation 10, and Player 6. VIX 1.14 was the release for VMware Fusion 7, Workstation 11 and Player 7. VIX 1.15 was the release for VMware Fusion 8, Workstation Pro 12 and Workstation Player 12. :param required_version: required vmrun version number """ vmrun_path = self.vmrun_path if not vmrun_path: vmrun_path = self.find_vmrun() try: output = await subprocess_check_output(vmrun_path) match = re.search(r"vmrun version ([0-9\.]+)", output) version = None if match: version = match.group(1) log.debug("VMware vmrun version {} detected, minimum required: {}".format(version, minimum_required_version)) if parse_version(version) < parse_version(minimum_required_version): raise VMwareError("VMware vmrun executable version must be >= version {}".format(minimum_required_version)) if version is None: log.warning("Could not find VMware vmrun version. Output: {}".format(output)) raise VMwareError("Could not find VMware vmrun version. Output: {}".format(output)) except (OSError, subprocess.SubprocessError) as e: log.error("Error while looking for the VMware vmrun version: {}".format(e)) raise VMwareError("Error while looking for the VMware vmrun version: {}".format(e)) async def remove_from_vmware_inventory(self, vmx_path): """ Removes a linked clone from the VMware inventory file. :param vmx_path: path of the linked clone VMX file """ async with self._vmware_inventory_lock: inventory_path = self.get_vmware_inventory_path() if os.path.exists(inventory_path): try: inventory_pairs = self.parse_vmware_file(inventory_path) except OSError as e: log.warning('Could not read VMware inventory file "{}": {}'.format(inventory_path, e)) return vmlist_entry = None for name, value in inventory_pairs.items(): if value == vmx_path: vmlist_entry = name.split(".", 1)[0] break if vmlist_entry is not None: for name in inventory_pairs.copy().keys(): if name.startswith(vmlist_entry): del inventory_pairs[name] try: self.write_vmware_file(inventory_path, inventory_pairs) except OSError as e: raise VMwareError('Could not write VMware inventory file "{}": {}'.format(inventory_path, e)) @staticmethod def parse_vmware_file(path): """ Parses a VMware file (VMX, preferences or inventory). :param path: path to the VMware file :returns: dict """ pairs = OrderedDict() encoding = "utf-8" # get the first line to read the .encoding value with open(path, "rb") as f: line = f.readline().decode(encoding, errors="ignore") if line.startswith("#!"): # skip the shebang line = f.readline().decode(encoding, errors="ignore") try: key, value = line.split('=', 1) if key.strip().lower() == ".encoding": file_encoding = value.strip('" ') try: codecs.lookup(file_encoding) encoding = file_encoding except LookupError: log.warning("Invalid file encoding detected in '{}': {}".format(path, file_encoding)) except ValueError: log.warning("Couldn't find file encoding in {}, using {}...".format(path, encoding)) # read the file with the correct encoding with open(path, encoding=encoding, errors="ignore") as f: for line in f.read().splitlines(): try: key, value = line.split('=', 1) pairs[key.strip().lower()] = value.strip('" ') except ValueError: continue return pairs @staticmethod def write_vmware_file(path, pairs): """ Write a VMware file (excepting VMX file). :param path: path to the VMware file :param pairs: settings to write """ encoding = "utf-8" if ".encoding" in pairs: file_encoding = pairs[".encoding"] try: codecs.lookup(file_encoding) encoding = file_encoding except LookupError: log.warning("Invalid file encoding detected in '{}': {}".format(path, file_encoding)) with open(path, "w", encoding=encoding, errors="ignore") as f: for key, value in pairs.items(): entry = '{} = "{}"\n'.format(key, value) f.write(entry) @staticmethod def write_vmx_file(path, pairs): """ Write a VMware VMX file. :param path: path to the VMX file :param pairs: settings to write """ encoding = "utf-8" if ".encoding" in pairs: file_encoding = pairs[".encoding"] try: codecs.lookup(file_encoding) encoding = file_encoding except LookupError: log.warning("Invalid file encoding detected in '{}': {}".format(path, file_encoding)) with open(path, "w", encoding=encoding, errors="ignore") as f: if sys.platform.startswith("linux"): # write the shebang on the first line on Linux vmware_path = VMware._get_linux_vmware_binary() if vmware_path: f.write("#!{}\n".format(vmware_path)) for key, value in pairs.items(): entry = '{} = "{}"\n'.format(key, value) f.write(entry) def _get_vms_from_inventory(self, inventory_path): """ Searches for VMs by parsing a VMware inventory file. :param inventory_path: path to the inventory file :returns: list of VMs """ vm_entries = {} vmware_vms = [] log.info('Searching for VMware VMs in inventory file "{}"'.format(inventory_path)) try: pairs = self.parse_vmware_file(inventory_path) for key, value in pairs.items(): if key.startswith("vmlist"): try: vm_entry, variable_name = key.split('.', 1) except ValueError: continue if vm_entry not in vm_entries: vm_entries[vm_entry] = {} vm_entries[vm_entry][variable_name.strip()] = value except OSError as e: log.warning("Could not read VMware inventory file {}: {}".format(inventory_path, e)) for vm_settings in vm_entries.values(): if "displayname" in vm_settings and "config" in vm_settings: if os.path.exists(vm_settings["config"]): log.debug('Found VM named "{}" with VMX file "{}"'.format(vm_settings["displayname"], vm_settings["config"])) vmware_vms.append({"vmname": vm_settings["displayname"], "vmx_path": vm_settings["config"]}) return vmware_vms def _get_vms_from_directory(self, directory): """ Searches for VMs in a given directory. :param directory: path to the directory :returns: list of VMs """ vmware_vms = [] log.info('Searching for VMware VMs in directory "{}"'.format(directory)) for path, _, filenames in os.walk(directory): for filename in filenames: if os.path.splitext(filename)[1] == ".vmx": vmx_path = os.path.join(path, filename) log.debug('Reading VMware VMX file "{}"'.format(vmx_path)) try: pairs = self.parse_vmware_file(vmx_path) if "displayname" in pairs: log.debug('Found VM named "{}"'.format(pairs["displayname"])) vmware_vms.append({"vmname": pairs["displayname"], "vmx_path": vmx_path}) except OSError as e: log.warning('Could not read VMware VMX file "{}": {}'.format(vmx_path, e)) continue return vmware_vms @staticmethod def get_vmware_inventory_path(): """ Returns VMware inventory file path. :returns: path to the inventory file """ if sys.platform.startswith("win"): return os.path.expandvars(r"%APPDATA%\Vmware\Inventory.vmls") elif sys.platform.startswith("darwin"): return os.path.expanduser("~/Library/Application Support/VMware Fusion/vmInventory") else: return os.path.expanduser("~/.vmware/inventory.vmls") @staticmethod def get_vmware_preferences_path(): """ Returns VMware preferences file path. :returns: path to the preferences file """ if sys.platform.startswith("win"): return os.path.expandvars(r"%APPDATA%\VMware\preferences.ini") elif sys.platform.startswith("darwin"): return os.path.expanduser("~/Library/Preferences/VMware Fusion/preferences") else: return os.path.expanduser("~/.vmware/preferences") @staticmethod def get_vmware_default_vm_paths(): """ Returns VMware default VM directory paths. :returns: path to the default VM directory """ if sys.platform.startswith("win"): import ctypes import ctypes.wintypes path = ctypes.create_unicode_buffer(ctypes.wintypes.MAX_PATH) ctypes.windll.shell32.SHGetFolderPathW(None, 5, None, 0, path) documents_folder = path.value return ['{}\My Virtual Machines'.format(documents_folder), '{}\Virtual Machines'.format(documents_folder)] elif sys.platform.startswith("darwin"): return [os.path.expanduser("~/Documents/Virtual Machines.localized")] else: return [os.path.expanduser("~/vmware")] async def list_vms(self): """ Gets VMware VM list. """ # check for the right VMware version await self.check_vmware_version() vmware_vms = [] inventory_path = self.get_vmware_inventory_path() if os.path.exists(inventory_path) and self.host_type != "player": # inventory may exist for VMware player if VMware workstation has been previously installed vmware_vms = self._get_vms_from_inventory(inventory_path) if not vmware_vms: # backup methods when no VMware inventory file exists or for VMware player which has no inventory file vmware_preferences_path = self.get_vmware_preferences_path() pairs = {} if os.path.exists(vmware_preferences_path): # the default vm path may be present in VMware preferences file. try: pairs = self.parse_vmware_file(vmware_preferences_path) except OSError as e: log.warning('Could not read VMware preferences file "{}": {}'.format(vmware_preferences_path, e)) if "prefvmx.defaultvmpath" in pairs: default_vm_path = pairs["prefvmx.defaultvmpath"] if not os.path.isdir(default_vm_path): raise VMwareError('Could not find or access the default VM directory: "{default_vm_path}". Please change "prefvmx.defaultvmpath={default_vm_path}" in "{vmware_preferences_path}"'.format(default_vm_path=default_vm_path, vmware_preferences_path=vmware_preferences_path)) vmware_vms = self._get_vms_from_directory(default_vm_path) if not vmware_vms: # the default vm path is not in the VMware preferences file or that directory is empty # let's search the default locations for VMs for default_vm_path in self.get_vmware_default_vm_paths(): if os.path.isdir(default_vm_path): vmware_vms.extend(self._get_vms_from_directory(default_vm_path)) if not vmware_vms: log.warning("Could not find any VMware VM in default locations") # look for VMX paths in the preferences file in case not all VMs are in a default directory for key, value in pairs.items(): m = re.match(r'pref.mruVM(\d+)\.filename', key) if m: display_name = "pref.mruVM{}.displayName".format(m.group(1)) if display_name in pairs: found = False for vmware_vm in vmware_vms: if vmware_vm["vmname"] == display_name: found = True if found is False: vmware_vms.append({"vmname": pairs[display_name], "vmx_path": value}) return vmware_vms @staticmethod def _get_linux_vmware_binary(): """ Return the path of the vmware binary on Linux or None """ path = shutil.which("vmware") if path is None: path = shutil.which("vmplayer") return path if __name__ == '__main__': loop = asyncio.get_event_loop() vmware = VMware.instance() print("=> Check version") loop.run_until_complete(asyncio.ensure_future(vmware.check_vmware_version()))

Having done very well in raising food grain production in the last decade, India will have to stick to 'out-of-box' measures and adopt a fresh strategy to ensure food security for its growing population in the next 10 years, a study has suggested. THE COUNTRY’S food grain production, comprising mainly rice, wheat, coarse grains and pulses, increased from 197 million tonnes in 2000-01 to 257 million tonnes in 2011-12. However, to raise the production in the same proportion to something like 320 million tonnes in the next eight to 10 years to feed our growing population will be a big challenge, given the fact that land resource is limited and the country needs to go for urbanization at an increased pace, industry chamber Assocham said in a study report. It goes to the credit of the ‘Green Revolution’ and efforts of our farmers that the country harvested rich crop of food grains without much increase in the acreage. For instance, the acreage under food grains cultivation in 2000-01 was 122 million hectares while the total production was 197 million tonnes. The area under cultivation went up by four million hectares to 126 million hectares but the production jumped up to 257 million tones. The study points out that India needs to constantly raise its food grains production and food security, first because our population in 2020 would be about 140-145 crore and secondly, most of our population is young. It goes without saying that youngsters are better eaters. And then, as a country we also need to improve on the nutrition scale as we strive to reduce the ratio of people below the present poverty level of about 30 per cent. “In fact, finishing the poverty level should be the first priority,” the study emphasized, fully supporting the UPA Government’s flagship programme ‘Food Security Bill’ under which rice and wheat would be sold to BPL families at Rs three and Rs two per kg respectively. The study pointed out that while the next level of revolution in pushing up food production is a challenging task, it is not impossible. However, it would require huge investment in raising the facilities for irrigation. As per World Bank report, only 35 per cent of India’s agricultural land has irrigation facilities and the rest depends totally on monsoon rains. As much as 60 per cent of India’s land of 2973190 square kilometer comprises agricultural land (1797090 Sq km) and only 35 per cent of it is under irrigation. “The productivity of irrigated land is almost double than the dry land. Besides, we can have at least double crop in a year on irrigated land whereas harvesting even a single crop would depend on the Rain God,” reveals the study, titled, “The Next Food Security Challenge”. Unfortunately, even though thousands of crores of rupees are earmarked for development of irrigation facilities, not much attention is paid and neither the sector receives any media attention. For instance, we should monitor the progress of the Rs 14,000 crore ‘Accelerated Irrigation Benefit Programme’, Rs 2,500 crore ‘Flood Management programme’ and Rs 550 crore water bodies development programme. “It is only when some scam takes place, like the one in Maharashtra that the media glare is seen on the sector,” the study observed regretfully.

Sending SMS with PHP and TextMagic: An A to Z guide Posted on Mar 26, 2012 Over the years, Short message service (SMS) has become a very important way of communication, and many businesses are looking for easy ways to send automated text messages to their customers. In this tutorial, I'm going to show you how you can send SMS using PHP and a third party service called TextMagic. Its very easy to do! Step 1: Creating a TextMagic account In order to send SMS to mobile phones, you need to use a third-party service. In this tutorial, I’m using a service called TextMagic to send SMS. There are lots of other services to do so, but I’ve tested Textmagic and I’m very happy with it so far. To use TextMagic, you have to create an account. Go here and register. Prices starts at $27 for 200 SMS (13.5 cents per sms) Step 2: Configure your API account Once you have created your TextMagic account, go to My services → API → Password. You need to generate an API password in order to be able to send SMS from your website. Just enter your account password and click on “Generate API password”. Once done, you have to download the API files. Go to this page and click on the “Download” button to get the API files. Extract the textmagic-sms-api-php.zip file and upload all of its content to your server. Step 3: Let’s code! Now, we have to create a function that will send the SMS throught the TextMagic API. The following code, taken from TextMagic website is the easiest way to send a SMS using the TextMagic API. So how does this code works? First, I’m including the TextMagic API. Then we have to instantiate a TextMagicAPI object. To do so, you need your TextMagic username as well as your API password. $phones is an array that can contains how many phone numbers as you want. Useful for bulk text messaging! Finally, the SMS is sent using the sent method. For testing purposes, you can use the 9991234567 number provided by TextMagic. It is totally free! Now, how to make sure your SMS has been sent? Easy, just see if $results is true:

Science to stop age clock at 50 - suprgeek http://news.bbc.co.uk/2/hi/health/8314442.stm ====== trebor Most people can drive their cars for years and years, because they give it the right maintenance and fuel. But somehow, they give their bodies almost no care, terrible fuel, and expect equivalent mileage? There's no replacement for prevention. "An ounce of prevention is worth a pound of cure."

Methodical and ethical aspects of nucleic acid diagnostics. A review. Aside from the established enzymatic and immunodiagnostic procedures, an increasing number of diagnostic procedures for nucleic acid detection--i.e. for the detection of the primary genetic information--has been developed in recent years. For the routine use of these diagnostic procedures in central analytical laboratories or by the general practitioner, automated DNA analysis methods with integrated highly sensitive detection systems have been developed. The most important objective of these developments--aside from the elucidation of the type of genetic defect on the molecular level through basic research--is the generation of a quantitative nonradioactive signal in corresponding analyzers. Detection methods using the ELISA principle as quantifiable reporter system--analogous to the automatic immunodiagnostic procedures--have hence been developed in recent years. Owing to the increasing importance of this analysis procedure alternative to the detection of bioactive low molecular weight substances or proteins--i.e. nucleic acid diagnostics--the following is an attempt to provide a survey of the methods and possibilities of application. Moreover, possibilities for nonradioactive signal generation and amplification will be presented. The chances and risks of genome diagnostics will be discussed in a final section.

Q: NHibernate - lazy loading: no session or session was closed I'm confused by the following NHibernate behaviour: Domain classes and mappings: public class Category { public virtual int ID { get; set; } public virtual string Name { get; set; } private IList<Product> _products; public virtual IList<Product> Products { get { return new List<Product>(_products).AsReadOnly(); } } public Category() { _products = new List<Product>(); } } public class Product { public virtual int ID { get; set; } public virtual string Name { get; set; } public virtual Category Category { get;set; } } public class ProductMap : ClassMap<Product> { public ProductMap() { Schema("dbo"); Table("tProducts"); Id(x => x.ID); Map(x => x.Name); References(x => x.Category).Column("CategoryID"); } } public class CategoryMap : ClassMap<Category> { public CategoryMap() { Schema("dbo"); Table("tCategories"); Id(x => x.ID); Map(x => x.Name); HasMany(x => x.Products) .KeyColumn("CategoryID") .Access.CamelCaseField(Prefix.Underscore) .Inverse() .Cascade.All(); } } Code causing trouble: Category category; using (var session = sessionFactory.OpenSession()) { category = session.Get<Category>(1); } using (var session = sessionFactory.OpenSession()) { var products = category.Products; // exception } Why do I get no session exception when I'm trying to get products? I've got a session here! How to avoid this exception (I prefer 2 sessions here, and I want to keep loading lazy)? Thanks in advance! A: Can you re-attach the object to your new session either: ISession.Update(myDetachedInstance); or, if the object has not been changed: ISession.Lock(myDetachedInstance, NHibernate.LockMode.None); For more info, see: http://intellect.dk/post/Detached-objects-in-nHibernate-and-Lazy-loading.aspx

Mechanical properties of femoral diaphysis and femoral neck of female rats chronically exposed to various levels of cadmium. The effect of chronic exposure to cadmium (Cd) on the mechanical properties of femoral diaphysis and femoral neck was investigated on a rat model of human exposure. Three-week-old female Wistar rats were exposed to Cd in drinking water at concentrations of 1, 5, 50, or 100 mg/L for 12 months. Biomechanical properties of the femoral diaphysis were evaluated in a three-point bending test and those of the femoral neck in a bending test with vertical loading of the head. Bone mineral content (BMC) and bone mineral density (BMD) at the whole femur, and BMD at the diaphysis and proximal femur (head and neck region) of the Cd-treated rats decreased in a dose-dependent manner, except for the diaphyseal BMD at a Cd concentration of 1 mg/L. Exposure to Cd concentrations of 1 and 5 mg/L had only little effect on the diaphyseal mechanical properties (decreased yield load with unchanged bending strength, stiffness, yield stress, ultimate stress, and Young modulus), whereas the bending strength and stiffness of the neck decreased and the yield load clearly tended to decline or declined. The effect of Cd at the two locations was more marked in the 50 and 100 mg/L groups, and changes in the bone geometry were observed in these animals. The results clearly revealed that chronic, even low-level, exposure to Cd results in demineralization and weakening of the femur. The femoral neck seems to be more vulnerable than the diaphysis to failure from Cd. We conclude that environmental exposure to Cd may be an important risk factor for femoral neck fracture.